PI 3 Kinase catalytic subunit alpha(PIK3CA) (NM_006218) Human Untagged Clone

CAT#: SC116227

PIK3CA (untagged)-Human phosphoinositide-3-kinase, catalytic, alpha polypeptide (PIK3CA)

USD 1,041.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PI 3 Kinase catalytic subunit alpha(PIK3CA) (NM_006218) Human Untagged Clone
Symbol PIK3CA
Synonyms CLOVE; CWS5; MCAP; MCM; MCMTC; p110-alpha; PI3K; PI3K-alpha
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC116227 sequence for NM_006218 edited (data generated by NextGen Sequencing)


ATGCCTCCACGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATCCTAGTAGAAT
GTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCTACATTAATAACCATAAAGCA
TGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCATCAACTTCTTCAAGATGAATCTTCTTACATTTTC
GTAAGTGTTACTCAAGAAGCAGAAAGGGAAGAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGC
TTTTTCAACCCTTTTTAAAAGTAATTGAACCAGTAGGCAACCGTGAAGAAAAGATCCTCAATCGAGAAAT
TGGTTTTGCTATCGGCATGCCAGTGTGTGAATTTGATATGGTTAAAGATCCAGAAGTACAGGACTTCCGA
AGAAATATTCTGAACGTTTGTAAAGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCATAGTAGAGCAA
TGTATGTCTATCCTCCAAATGTAGAATCTTCACCAGAATTGCCAAAGCACATATATAATAAATTAGATAA
AGGGCAAATAATAGTGGTGATCTGGGTAATAGTTTCTCCAAATAATGACAAGCAGAAGTATACTCTGAAA
ATCAACCATGACTGTGTACCAGAACAAGTAATTGCTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGC
TATCCTCTGAACAACTAAAACTCTGTGTTTTAGAATATCAGGGCAAGTATATTTTAAAAGTGTGTGGATG
TGATGAATACTTCCTAGAAAAATATCCTCTGAGTCAGTATAAGTATATAAGAAGCTGTATAATGCTTGGG
AGGATGCCCAATTTGATGTTGATGGCTAAAGAAAGCCTTTATTCTCAACTGCCAATGGACTGTTTTACAA
TGCCATCTTATTCCAGACGCATTTCCACAGCTACACCATATATGAATGGAGAAACATCTACAAAATCCCT
TTGGGTTATAAATAGTGCACTCAGAATAAAAATTCTTTGTGCAACCTACGTGAATGTAAATATTCGAGAC
ATTGATAAGATCTATGTTCGAACAGGTATCTACCATGGAGGAGAACCCTTATGTGACAATGTGAACACTC
AAAGAGTACCTTGTTCCAATCCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCC
TCGTGCTGCTCGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGT
CCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAAATGGCTTTGA
ATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGTGTTACTGGATCAAATCCAAA
TAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTCAGCAGTGTGGTAAAGTTCCCAGATATGTCA
GTGATTGAAGAGCATGCCAATTGGTCTGTATCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGGACTGA
GTAACAGACTAGCTAGAGACAATGAATTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACACG
AGATCCTCTCTCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGACACTATTGTGTAACT
ATCCCCGAAATTCTACCCAAATTGCTTCTGTCTGTTAAATGGAATTCTAGAGATGAAGTAGCCCAGATGT
ATTGCTTGGTAAAAGATTGGCCTCCAATCAAACCTGAACAGGCTATGGAACTTCTGGACTGTAATTACCC
AGATCCTATGGTTCGAGGTTTTGCTGTTCGGTGCTTGGAAAAATATTTAACAGATGACAAACTTTCTCAG
TATTTAATTCAGCTAGTACAGGTCCTAAAATATGAACAATATTTGGATAACTTGCTTGTGAGATTTTTAC
TGAAGAAAGCATTGACTAATCAAAGGATTGGGCACTTTTTCTTTTGGCATTTAAAATCTGAGATGCACAA
TAAAACAGTTAGCCAGAGGTTTGGCCTGCTTTTGGAGTCCTATTGTCGTGCATGTGGGATGTATTTGAAG
CACCTGAATAGGCAAGTCGAGGCAATGGAAAAGCTCATTAACTTAACTGACATTCTCAAACAGGAGAAGA
AGGATGAAACACAAAAGGTACAGATGAAGTTTTTAGTTGAGCAAATGAGGCGACCAGATTTCATGGATGC
TCTACAGGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAACTAGGAAACCTCAGGCTTGAAGAGTGTCGA
ATTATGTCCTCTGCAAAAAGGCCACTGTGGTTGAATTGGGAGAACCCAGACATCATGTCAGAGTTACTGT
TTCAGAACAATGAGATCATCTTTAAAAATGGGGATGATTTACGGCAAGATATGCTAACACTTCAAATTAT
TCGTATTATGGAAAATATCTGGCAAAATCAAGGTCTTGATCTTCGAATGTTACCTTATGGTTGTCTGTCA
ATCGGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAATTCTCACACTATTATGCAAATTCAGTGCAAAG
GCGGCTTGAAAGGTGCACTGCAGTTCAACAGCCACACACTACATCAGTGGCTCAAAGACAAGAACAAAGG
AGAAATATATGATGCAGCCATTGACCTGTTTACACGTTCATGTGCTGGATACTGTGTAGCTACCTTCATT
TTGGGAATTGGAGATCGTCACAATAGTAACATCATGGTGAAAGACGATGGACAACTGTTTCATATAGATT
TTGGACACTTTTTGGATCACAAGAAGAAAAAATTTGGTTATAAACGAGAACGTGTGCCATTTGTTTTGAC
ACAGGATTTCTTAATAGTGATTAGTAAAGGAGCCCAAGAATGCACAAAGACAAGAGAATTTGAGAGGTTT
CAGGAGATGTGTTACAAGGCTTATCTAGCTATTCGACAGCATGCCAATCTCTTCATAAATCTTTTCTCAA
TGATGCTTGGCTCTGGAATGCCAGAACTACAATCTTTTGATGACATTGCATACATTCGAAAGACCCTAGC
CTTAGATAAAACTGAGCAAGAGGCTTTGGAGTATTTCATGAAACAAATGAATGATGCACATCATGGTGGC
TGGACAACAAAAATGGATTGGATCTTCCACACAATTAAACAGCATGCATTGAACTGA


Clone variation with respect to NM_006218.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006218 unedited
NCCTGTTCAAATTTGTATCCGACTCACTATAGGCGGCCGCGCAATTCGCACGAGGAGGGA
GCGCACAAGAGGTCTTTCTAGAAACAGTCTGCATATTCTTTAATGAATTAGAGTTGTGAT
TTCATCTTGGTGAAGCTTCCTCATTCCAGCACTGCGCCTTTGTGCACATGCAGGACCTGG
GTTTTCGGAACGATGTTTTGAATCATAGTTTGTGTGGCCGGGGAGAACCCCTTAGAATAC
TTGGGTTTCTGCTTTGGGACAACCATACATCTAATTCCTTAAAGTAGTTTTATATGTAAA
ACTTGCAAAGAATCAGAACAATGCCTCCACGACCATCATCAGGTGAACTGTGGGGCATCC
ACTTGATGCCCCCAAGAATCCTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTT
TAGAATGCCTCCGTGAGGCTACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAA
GAAAATACCCCCTCCATCAACTTCTTCAAGATGAATCTTCTTACATTTTCGTAAGTGTTA
CTCAAGAAGCAGAAAGGGAAGAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGC
TTTTTCAACCCTTTTTAAAAGTAATTGAACCAGTAGGCAACCGTGAAGAAAAGATCCTCA
ATCGAGAAATTGGTTTTGCTATCGGCATGCCAGTGTGTGAATTTGATATGGTTAAAGATC
CAGAAGTACAGGACTTTCGAAGAATATTCTGAACGTTTGTAAAGAAGCTGTGGATCTTTT
AGGACCTCATTCACCTCATAGTAGAGCAATGTATGTCTATCCTCCAATGTAGAATCTTCA
CCAGAATGCCAAAGCCATATTTTATAATAGATAAAGGCAATN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006218 unedited
ACCGCGGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTACTTTGTGGGAGCCCA
GAATTTCCCTGGGAAATAAGAATAAGATCCTTTAAATACTGTCCAGAAGAAAAAAAAAAA
TACCACCTTATAACAGGTCTCATTTGTGACTGCTTCCAAAACTGCAGATAAAACCTCAAA
TCATCAAAAGGTTTGATTTATTAAAAAGAAAAAGTCTCTGGTGAAATCTCAAGAGTCCCT
TCCACCCCAAGCATTTTTCTTCATTAAACAAGCAGTCAAAAACCCACTTCAAACTATAAA
TTGAACAGCAATGGAAAAATAAGAAATTTTCATTCTTTTCCAATCAATGTAATTTAACAT
AAACTCCAGTTTACTTACACCTAATGCAATAACAGCCTTTGTTGTGTCCACATTTCAAAA
CATAGAACATTTGCAAGACAAAAAAACCATCACTTTTTCCTTCTCCATCATTTCTATATA
TTTTGGGGATTTTTGTTTTGTTTTGTTTTTTAAAAAAAGATACAAACAATCTTCAAAGTT
TACCTTTTTGGACTTAAGGCATAACATGAAATTGCGCATTATTCTAAAGCTTAATTTTGA
AATGAACTAGTTTAAGTGCTATCAAACCCTGTTTGCGTTTACATTATTTAAATTATATAG
NATTTTATTTCTGTTCTTGCTGNAAATCTAATGCTGTTCATGGATTGTGCAATTCCTATG
CNATCGGTCTTTGCCTGCTGAGAGTTATTAACAGNTGCAGTGTGGAATCCAGAGTGAGCT
TTCATTTTCTCAGNTATCTTTTTCAGTCATGCATGCTGTTTAATGTGTGGAAGATCCATC
CATTTTGNTGTCCAGCACATGATGTGCTCATTCATTNGNTATGAATACTNCAAAGCCTCT
GCTCAGTTTACTAGGCTAAGGTCTTCAATGATGCATGCATAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006218
ORF Size 3207 bp
Insert Size 4530
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006218.2, NP_006209
RefSeq Size 9104
Locus ID 5290
Cytogenetics 3q26.32
Domains PI3K_rbd, PI3_PI4_kinase, PI3Ka, PI3K_C2, PI3K_p85B
Protein Families Druggable Genome
Protein Pathways Inositol phosphate metabolism, ErbB signaling pathway, Chemokine signaling pathway, Phosphatidylinositol signaling system, mTOR signaling pathway, Apoptosis, VEGF signaling pathway, Focal adhesion, Toll-like receptor signaling pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Leukocyte transendothelial migration, Neurotrophin signaling pathway, Regulation of actin cytoskeleton, Insulin signaling pathway, Progesterone-mediated oocyte maturation, Type II diabetes mellitus, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer
Gene Summary Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations