UQCRB (NM_006294) Human Untagged Clone

CAT#: SC116201

UQCRB (untagged)-Human ubiquinol-cytochrome c reductase binding protein (UQCRB), nuclear gene encoding mitochondrial protein, transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name UQCRB (NM_006294) Human Untagged Clone
Symbol UQCRB
Synonyms MC3DN3; QCR7; QP-C; QPC; UQBC; UQBP; UQCR6; UQPC
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_006294 edited
ATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGGTATTCGAAAATGG
TATTACAATGCTGCAGGATTCAATAAACTGGGGTTAATGCGAGATGATACAATATACGAG
GATGAAGATGTAAAAGAAGCCATAAGAAGACTTCCTGAGAACCTTTATAATGACAGGATG
TTTCGCATTAAGAGGGCACTGGACCTGAACTTGAAGCATCAGATCTTGCCTAAAGAGCAG
TGGACCAAATATGAAGAGGAAAATTTCTACCTTGAACCGTATCTGAAAGAGGTTATTCGG
GAAAGAAAAGAAAGAGAAGAATGGGCAAAGAAGTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006294 unedited
CTTTTCGGATTTTGTATACGACTCCTATAGGCGGCCGCCGAATTCGCACGAGGCTCTTTC
TGGTCAAAAGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGGTATCTC
GAAAATGGTATTACAATGCTGCAGGATTCAATAAACTGGGGTTAATGCGAGATGATACAA
TATACGAGGATGAAGATGTAAAAGAAGCCATAAGAAGACTTCCTGAGAACCTTTATAATG
ACAGGATGTTTCGCATTAAGAGGGCACTGGACCTGAACTTGAAGCATCAGATCTTGCCTA
AAGAGCAGTGGACCAAATATGAAGAGGAAAATTTCTACCTTGAACCGTATCTGAAAGAGG
TTATTCGGGAAAGAAAAGAAAGAGAAGAATGGGCAAAGAAGTAATCATGTAGTTGAAGTC
TGTGGATGCAGCTGTTATGAAGATGGTTAAACTTGAAACAAACAATTTTAAGAATTATTT
GGTCTGAAGATGTTTTACTTTAAATAAATGTCTATTGTAATGGAAAAAAAAAAAAAAATA
AACAAAAAAAAAACAAAAACCCTCGACTCTAAATTGCGGCCGCGGTCATAGCTGTTTCCC
TGAACAGATCCCGGGTGGGATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAA
GTTGCCACTCCAGTGCCCACCACCCTTGCCCTAATAAAATTAAGTTGCATCATTTTGTCT
GACTAGGNGTCCTTCTATAATATTATGGGGTGGAGTGGTGGGGTTTGCCCCCACGGTCAC
ATTCGTCAATAACCCCCTCTGCCCCTGCGGCCTCTATTGGCCACCCAATTGTGAATGCAC
GAGCCCCATTCTGGCGATATTGACCTTACCCCCCCTCGCCCCACCTGATGCACCTCCCCC
ACCTCCCACATT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006294 unedited
TGGCAACTCTCCAGGTCCAGGNANAGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGA
TCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTCCCATTACAATAGACTTTTATTTAAAGTAAAACATTT
TCAAACCAAATAATTCTTAAAATGGTTGGTTTAAAGTTTAACCATTTTCATAACAGGTGC
ATCCACAGACTTCAACTACATGATTACTTCTTTGCCCATTCTTCTCTTTCTTTTCTTTCC
CGAATAACCTTTTTCAAATACGGTTCAAGGAAAAAATTTTCCTTTTCATATTGGGCCCAC
TGCTCTTTAGGCAAAATCTGATGCTTAAAGTTCAGGCCCAGGGCCCTTTTAATGCAAAAC
ATCCTGTCATTATAAAGGTTCTCAGGAAGTCTTCTTATGGCTTCTTTTACATCTTCATCC
TCGAATATGGAATCATCTCGCATTAACCCCAGTTTATTGAATCCTGCAGCATTGTAATAC
CATTTTCAAATACCATCCAGCCACTTGCCTGATGCTGAAACGGCCTGCTTACCAGCCATT
TTGACCAGAAAGAGCCCTCGTGCCGAATTCGCGGCCGCCCTATAGGGAGTCGTATTACAA
AATTCTGACGGTTCACTAAACGAGCTCTGCTATATAGACCTCCCACCGTACACGCCTACC
GCCCATTTGCGTCAACGGGGCGGGGGTTATACGACATTTTGGAAAAGTCCCGTTGATTTT
TGGTGCCAAACAACCTCCCTTGGACGTCAAGGGGGTGGGACTTGGAATCCCCGTGAGTCA
ACCGTTATCACGCCATTGGGGTCTGCCAAACCGNTCACATGGGATAGCGAGACTAACCCG
AATGCC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006294
ORF Size 336 bp
Insert Size 550
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006294.2, NP_006285
RefSeq Size 965
Locus ID 7381
Cytogenetics 8q22.1
Domains UCR_14kD
Protein Pathways Oxidative phosphorylation, Metabolic pathways, Cardiac muscle contraction, Alzheimer's disease, Parkinson's disease, Huntington's disease
Gene Summary This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This component is involved in redox-linked proton pumping. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.