SLC9A6 (NM_006359) Human Untagged Clone

CAT#: SC116146

SLC9A6 (untagged)-Human solute carrier family 9 (sodium/hydrogen exchanger), member 6 (SLC9A6), transcript variant 2

USD 1,288.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SLC9A6 (NM_006359) Human Untagged Clone
Symbol SLC9A6
Synonyms MRSA; NHE6
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006359, the custom clone sequence may differ by one or more nucleotides


ATGGCTCGGCGCGGCTGGCGGCGGGCACCCCTCCGCCGTGGCGTCGGCAGCAGTCCCCGAGCCCGCAGGC
TCATGCGGCCCCTTTGGTTGCTCCTCGCAGTGGGCGTCTTTGACTGGGCAGGGGCTTCGGACGGCGGCGG
CGGAGAGGCTAGAGCCATGGACGAGGAGATCGTGTCCGAGAAGCAAGCCGAGGAGAGCCACCGGCAGGAC
AGCGCCAACCTGCTCATCTTCATCCTGCTGCTCACCCTCACCATTCTCACAATCTGGCTCTTCAAGCACC
GCCGGGCCCGCTTCCTGCACGAAACCGGCCTGGCTATGATTTATGGTCTTTTGGTGGGCCTTGTGCTTCG
GTATGGCATTCATGTTCCGAGTGATGTAAATAATGTGACCCTGAGCTGTGAAGTGCAGTCAAGTCCAACT
ACCTTACTGGTTACTTTTGATCCAGAAGTATTTTTCAACATATTACTTCCTCCTATCATATTTTATGCAG
GTTATAGCCTGAAAAGGAGACATTTTTTTCGAAATCTTGGGTCTATCCTAGCATACGCTTTTCTTGGAAC
AGCAATTTCTTGTTTCGTTATTGGGTCAATAATGTATGGCTGTGTAACGCTGATGAAGGTAACGGGACAA
CTTGCAGGAGATTTTTACTTTACAGATTGCCTACTGTTTGGTGCCATTGTATCAGCAACTGATCCAGTGA
CTGTTCTTGCTATATTCCACGAGCTTCAAGTTGATGTTGAACTCTATGCACTTCTTTTTGGTGAAAGTGT
CCTCAATGATGCTGTTGCCATAGTGCTGTCCTCCTCAATAGTGGCATACCAGCCAGCTGGAGACAACAGT
CACACCTTTGATGTCACAGCGATGTTCAAGTCTATTGGGATCTTCCTTGGAATCTTCAGTGGATCTTTTG
CAATGGGTGCTGCTACTGGAGTGGTGACAGCTTTAGTGACAAAGTTCACCAAATTACGGGAGTTCCAGTT
GTTGGAGACAGGCCTGTTCTTCTTGATGTCCTGGAGTACCTTCCTCTTGGCTGAAGCATGGGGCTTCACA
GGTGTAGTTGCAGTATTGTTTTGTGGCATCACACAAGCACATTATACGTATAATAATTTGTCCACGGAGT
CTCAGCATAGAACTAAACAGTTGTTTGAGCTTCTCAATTTCTTGGCAGAGAATTTCATCTTCTCCTACAT
GGGGCTGACACTGTTCACCTTCCAGAACCATGTCTTTAACCCAACATTTGTAGTAGGAGCATTTGTTGCT
ATTTTCTTGGGAAGAGCTGCCAATATTTACCCCTTGTCCCTCTTACTTAATTTGGGTAGAAGAAGTAAGA
TTGGATCAAATTTTCAACACATGATGATGTTTGCTGGCCTTCGTGGTGCAATGGCATTTGCCTTGGCCAT
TCGAGATACTGCCACTTATGCACGGCAAATGATGTTCAGCACCACGCTTCTGATTGTGTTTTTTACCGTG
TGGGTATTTGGTGGTGGCACCACTGCAATGCTGTCATGCTTGCATATCAGGGTTGGTGTTGATTCAGACC
AAGAACACTTGGGTGTTCCTGAAAATGAAAGGAGAACTACCAAAGCAGAGAGTGCTTGGCTTTTCCGGAT
GTGGTACAACTTTGATCATAACTATCTGAAGCCTCTGCTGACCCACAGCGGGCCTCCGCTGACAACAACA
CTCCCTGCCTGCTGTGGACCCATCGCCAGGTGCCTCACCAGCCCCCAGGCTTACGAAAACCAGGAACAGT
TGAAAGATGATGATTCTGATCTTATTCTCAATGATGGTGACATCAGTTTGACATATGGAGATTCTACTGT
GAACACTGAACCGGCCACATCCAGCGCCCCAAGGAGATTTATGGGAAACAGTTCTGAAGATGCCTTGGAT
CGGGAGCTTGCATTTGGGGACCATGAACTGGTCATTCGAGGAACACGCCTGGTTCTTCCAATGGATGATT
CTGAACCCCCGCTAAATTTGTTAGATAATACGAGACATGGTCCAGCCTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_006359 unedited
GCATTTTGTATACGACTCCTATAGGCGGCCGCGAATTCGGCACGAGGGCGGGGGGAGACA
TGGCTCGGCGCGGCTGGCGGCGGGCACCCCTCCGCCGTGGCGTCGGCAGCAGTCCCCGAG
CCCGCAGGCTCATGCGGCCCCTTTGGTTGCTCCTCGCAGTGGGCGTCTTTGACTGGGCAG
GGGCTTCGGACGGCGGCGGCGGAGAGGCTAGAGCCATGGACGAGGAGATCGTGTCCGAGA
AGCAAGCCGAGGAGAGCCACCGGCAGGACAGCGCCAACCTGCTCATCTTCATCCTGCTGC
TCACCCTCACCATTCTCACAATCTGGCTCTTCAAGCACCGCCGGGCCCGCTTCCTGCACG
AAACCGGCCTGGCTATGATTTATGGTCTTTTGGTGGGCCTTGTGCTTCGGTATGGCATTC
ATGTTCCGAGTGATGTAAATAATGTGACCCTGAGCTGTGAAGTGCAGTCAAGTCCAACTA
CCTTACTGGTAAATGTTAGTGGAAAATTTTATGAGTATATGCTGAAAGGAGAGATTAGTT
CACATGAACTCAATAATGTTCAAGATAATGAAATGCTTAGAAAGGTTACTTTTGATCCAG
AAGTATTTTTCAACATATTACTTCCTCCTATCATATTTTATGCAGGTTATAGCCTGGAAA
GGAGACATTCTTTTCGAAATCTGGGTCTATCCTAGCATACGCTTTTCTTGGAACAGCAAT
TTCTTGTTTCGTTATTGCGTCACTAATGTATGGCTGTGTAACGCTGATGAAAGTAACGGG
ACAACTTGCCAGAGAATTTTACTTTACAGATTGCCTACTGGTTGGTGCCCTTGTATCAGC
AACTGATCCAGNGACTGGTTTTGCTTTATTCACGAGCTTCAGNTGATGTTGAACTCTATG
CCCTCCCTTTTGTGAAAGGGTGCCCAATGATGCTGTTGCCACTAAGC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006359 unedited
ACTTTGGACCGGCGGCCGCATNCTANGATCGAGTTTTTTTTTTTTTTTTTTGGGTATTTG
CAAGGCTATAACTTTTTTAATGACAGATTTTCCTAAAAGAAACCACTATAACATCTGTCC
AAGTACTCCAGGAGAAAACAAAAAATACATAAAGATTAAAAGTCTATTACTTTAACAGCA
CATTGCCAAACACGGACAACTAGGATAAATGCCAAGAAACCTTAAAAAATAACTTTAAAA
GATGCAACGTTCAAGCCATTCAAACGCGTAGGTTCCACAAACAACAGGAAAACAAGTCCA
AGAGCAGTTCTACTTGTGCATGATGGTAACTCAGACTGTACTTCATCAAAGTTCATTCAG
GTGTTTCATAGGCGTCTGAGCAGAGTTTGTTTTTTCTTCCTTGCTTGGAGATGTGTACAC
AGATTAGAGGAGAGGAAAGTCTTCCAGATGCTGATGTAAGCACAGCAGGCTTGGTTCCCC
TTGATAAAGTATGAAGGCAGATTTAGTTGACTCAAGCTTTATCAGTTTCCCTAGTGAAAA
GTCTTATGCATGCTGAAATAGACGAGTTACTGAATNTGTCATGCGAAGTATTTACATAAA
GTGAGGTCAGTAACCCGACAGAATAAAAAAGGTAGTTGTAAATTATTGTATAACCTTTTA
CACTTGAATAACTTGTGGGGAAGTGACACTGGACGTCAACTCCTCAACATACTTAACAAG
AATTTTACTGCGTGAAGAGCCACATCATGTAAAATACACGTATGGGAGGGATCCTGCATA
CAGGAAAGTCGCTCCACTACATACAATGGCTTGCCAACAGTCAGCTGCCCGAAGGGTACA
CATTAGATNCCCTAATTCAAGGATGTTGCATACCAGAAGATGCTTTCGAATAAGTACTGG
TTGGTC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006359
ORF Size 2010 bp
Insert Size 4260
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006359.1, NP_006350
RefSeq Size 4452
Locus ID 10479
Cytogenetics Xq26.3
Domains Na_H_Exchanger
Protein Families Transmembrane, Druggable Genome
Protein Pathways Cardiac muscle contraction
Gene Summary This gene encodes a sodium-hydrogen exchanger that is amember of the solute carrier family 9. The encoded protein localizes to early and recycling endosomes and may be involved in regulating endosomal pH and volume. Defects in this gene are associated with X-linked syndromic mental retardation, Christianson type. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010].
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform b), compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.