PHLDA3 (NM_012396) Human Untagged Clone

CAT#: SC115414

PHLDA3 (untagged)-Human pleckstrin homology-like domain, family A, member 3 (PHLDA3)


  "NM_012396" in other vectors (6)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PHLDA3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PHLDA3
Synonyms TIH1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC115414 sequence for NM_012396 edited (data generated by NextGen Sequencing)
ATGACGGCGGCGGCGACGGCTACCGTGCTCAAGGAGGGCGTGCTGGAGAAGCGCAGCGGC
GGGCTGCTGCAGCTGTGGAAGCGGAAGCGCTGCGTCCTCACCGAACGCGGGCTGCAGCTC
TTCGAGGCCAAGGGCACGGGCGGCCGGCCCAAGGAGCTCAGCTTCGCCCGCATCAAGGCC
GTGGAGTGCGTGGAGAGCACCGGGCGCCACATCTACTTCACGCTGGTGACCGAAGGGGGC
GGCGAGATCGACTTCCGCTGCCCCCTGGAAGATCCCGGCTGGAACGCCCAGATCACCCTA
GGCCTGGTCAAGTTCAAGAACCAGCAGGCCATCCAGACAGTGCGGGCCCGGCAGAGCCTC
GGGACCGGGACCCTCGTGTCCTAA

Clone variation with respect to NM_012396.3
>OriGene 5' read for NM_012396 unedited
AGTATTTTGTAATACGACTTCACTATAGGGCGGCCGCGAATTCGCACCAGGAACATGTAA
GGGCACATCCCGCGAGCTGCCGCCCAGCGCGCAGACAGAGCCCAGGGGAGCAAGAGAACG
GGCGGGCGGTGGGGCTCACGGCCTAGGGAGGCGCGGAGGCATCTGGCAGAGGCGGGTCGG
GCTGGGCCAGCTGGGGTAGAGCGGAGGAGCGGGTGCCGGCTGAAGCGGGGCGGTGGGCGC
GGAGCGCGCTGGGGGCACCGACACCACCTCACCGGCAGCCGGGTGCTGAGGGCCGCGGTG
TGGGTGCGCGGAGCAGTCAGGGCGCAGGTGGGCAGCGCGCACGGCCTGCCAGCCCGGGGC
GCCAGAATCCTGCGCTGCGGGGCCGAGAGGGGCGCCGCGCCCGCCGCAGCCTGGAGCTTT
CCGCGAACCTCGGGGCGCCCATGACGGCGGCGGCGACGGCTACCGTGCTCAAGGAGGGCG
TGCTGGAGAAGCGCAGCGGCGGGCTGCTGCAGCTGTGGAAGCGGAAGCGCTGCGTCCTCA
CCGAACGCGGGCTGCAGCTCTTCGAGGCCAAGGGCACGGGCGGCCGGCCCAAGGAGCTCA
GCTTCGCCCGCATCAAGGCCGTGGAGTGCGTGGAGAGCACCGGGCGCCACATCTACTTCA
CGCTGGTGACCGAAGGGGGCGGCGAGATCGACTTCCGCTGCCCCCTGGAAGATCCCGGCT
GGAACGCCCAGATCACCCTAGGCCTGGTCAAGTTCAAGAACCAGCAGGCCATCCAGACAG
TGCGGGCCCGGCAGAGCCTCGGGACCGGGACCCTCGTGTCCTAAACCACCGGGCGCACCA
TCTTTCCTTCATGCTACCCACCACCTCAGTGCTGAGGTCAAGCAGCTTTCTTTGTTCCTC
TGGCTTGTGGGGGCACGGCTGTGCTCCATGTGGC
Restriction Sites NotI-NotI     
ACCN NM_012396
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_012396.2, NP_036528.1
RefSeq Size 1607 bp
RefSeq ORF 384 bp
Locus ID 23612
UniProt ID Q9Y5J5
Cytogenetics 1q32.1
Domains PH
Gene Summary p53/TP53-regulated repressor of Akt/AKT1 signaling. Represses AKT1 by preventing AKT1-binding to membrane lipids, thereby inhibiting AKT1 translocation to the cellular membrane and activation. Contributes to p53/TP53-dependent apoptosis by repressing AKT1 activity. Its direct transcription regulation by p53/TP53 may explain how p53/TP53 can negatively regulate AKT1. May act as a tumor suppressor.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the functional protein. CCDS Note: This CCDS ID represents the protein described in PMID: 19203586 and is supported by BC014390.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 19203586. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.