CTNNA3 (NM_013266) Human Untagged Clone

CAT#: SC115321

CTNNA3 (untagged)-Human catenin (cadherin-associated protein), alpha 3 (CTNNA3), transcript variant 1

USD 1,710.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CTNNA3 (NM_013266) Human Untagged Clone
Symbol CTNNA3
Synonyms ARVD13; VR22
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_013266, the custom clone sequence may differ by one or more nucleotides


ATGTCAGCTGAAACACCAATCACATTGAATATCGATCCTCAGGATCTGCAGGTCCAAACATTCACCGTGG
AGAAGCTACTGGAGCCTCTCATAATCCAGGTTACCACACTTGTAAACTGTCCCCAGAACCCTTCCAGCAG
GAAAAAAGGACGTTCGAAAAGAGCCAGTGTCCTTCTAGCTTCTGTGGAGGAAGCAACTTGGAATTTATTA
GACAAGGGAGAGAAGATTGCCCAGGAAGCTACAGTTTTAAAGGATGAGCTTACGGCTTCACTTGAGGAAG
TTCGCAAAGAAAGTGAAGCTCTGAAAGTATCAGCTGAGAGATTTACAGATGACCCCTGTTTTCTCCCAAA
AAGGGAGGCTGTGGTTCAAGCTGCCCGTGCCTTGCTGGCTGCGGTGACGAGACTCCTTATCCTTGCGGAC
ATGATTGATGTCATGTGCCTCTTGCAACATGTGTCAGCTTTTCAAAGGACATTTGAGTCTCTCAAAAATG
TTGCCAACAAATCTGACCTCCAGAAAACCTACCAGAAGCTTGGGAAGGAGCTGGAAAATTTGGATTATTT
AGCCTTCAAACGTCAGCAGGACTTAAAATCTCCAAATCAGAGAGATGAAATTGCAGGAGCCCGAGCTTCA
CTGAAGGAGAACTCTCCCCTCTTGCATTCAATTTGTTCAGCTTGTTTGGAGCATTCTGATGTTGCTTCCC
TCAAAGCAAGCAAGGACACAGTTTGTGAAGAAATTCAGAATGCTCTCAATGTAATTTCAAATGCTTCACA
AGGGATCCAGAATATGACAACCCCACCAGAACCTCAGGCAGCAACCCTGGGAAGTGCCCTTGATGAGCTG
GAGAATTTAATTGTCCTGAATCCACTCACAGTAACTGAGGAGGAAATACGACCATCACTAGAGAAACGCC
TTGAAGCCATTATCAGTGGGGCTGCTCTGCTGGCGGATTCTTCATGTACGAGGGACTTACACCGAGAGCG
GATTATCGCAGAATGCAACGCCATTCGCCAGGCTCTTCAGGATCTGCTTTCAGAGTACATGAACAACGCT
GGAAAAAAAGAAAGGAGTAATACCCTGAATATTGCTTTAGACAACATGTGTAAGAAGACAAGAGACCTTC
GCAGACAGCTCCGCAAGGCTATTATAGATCATGTGTCAGACTCTTTCCTGGATACGACAGTCCCTCTTTT
GGTTCTCATTGAAGCTGCTAAGAATGGCCGGGAAAAGGAAATAAAAGAATATGCTGCGATATTTCATGAA
CACACCAGCAGGCTTGTAGAGGTGGCAAATCTTGCTTGTTCCATGTCAACAAATGAAGATGGAATTAAAA
TTGTCAAAATTGCAGCCAATCATTTGGAAACCTTGTGTCCACAGATTATTAATGCTGCACTTGCTTTGGC
TGCAAGACCCAAAAGTCAAGCGGTCAAAAACACCATGGAAATGTACAAGCGTACATGGGAGAATCATATA
CATGTCCTCACTGAAGCCGTAGATGACATTACAAGCATTGATGACTTCCTTGCTGTATCTGAAAGCCATA
TCTTGGAAGATGTCAACAAGTGTATCATAGCCTTAAGAGACCAGGATGCTGATAATTTAGACCGTGCTGC
GGGTGCTATCAGAGGCCGGGCAGCAAGAGTTGCTCACATCGTCACGGGTGAAATGGACAGTTACGAGCCA
GGGGCTTACACGGAAGGTGTAATGAGAAATGTTAACTTCCTTACAAGTACTGTAATTCCTGAATTTGTAA
CACAAGTGAATGTTGCCTTGGAAGCCTTAAGCAAAAGCTCATTGAATGTGTTGGATGATAATCAATTTGT
GGACATCTCAAAGAAGATCTATGATACAATTCATGATATCAGATGTTCAGTCATGATGATTCGGACCCCA
GAGGAACTGGAGGATGTTTCTGACCTTGAAGAGGAACACGAGGTCCGCAGTCACACCAGCATTCAGACCG
AAGGGAAAACTGATAGGGCTAAGATGACTCAACTGCCTGAGGCAGAAAAAGAAAAGATTGCTGAGCAAGT
TGCTGATTTCAAGAAAGTAAAGAGTAAGCTGGATGCTGAGATTGAGATATGGGATGATACAAGCAACGAC
ATCATTGTTCTGGCCAAGAACATGTGTATGATCATGATGGAGATGACAGACTTCACTAGGGGCAAAGGAC
CACTAAAGCATACAACTGATGTGATCTATGCAGCGAAAATGATATCAGAATCAGGATCAAGGATGGATGT
CCTTGCTCGGCAGATTGCTAATCAGTGCCCAGATCCATCTTGTAAACAGGACTTGTTGGCCTACCTGGAA
CAGATTAAGTTCTACTCCCACCAACTGAAAATCTGCAGTCAAGTTAAAGCTGAGATCCAGAACCTGGGAG
GAGAGCTCATCATGTCAGCTTTGGACAGTGTCACATCCCTGATCCAAGCAGCCAAAAATTTAATGAATGC
TGTAGTGCAAACAGTGAAAATGTCTTACATTGCCTCAACCAAGATCATCCGAATCCAGAGTCCTGCTGGG
CCCCGGCACCCAGTTGTGATGTGGAGAATGAAGGCTCCTGCAAAAAAACCCTTGATTAAAAGAGAGAAGC
CAGAGGAAACGTGTGCAGCTGTCAGACGAGGCTCAGCAAAGAAAAAAATCCATCCATTGCAAGTCATGAG
TGAATTTAGAGGAAGACAAATCTACTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_013266 unedited
TCTTACACCCGCCCGTTGCCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAA
GCAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGC
GAATTCGGCACCAGGGAAGGCAACTCGACCTTTGGAAGCCTCTATGTTGTGACTCCACTT
GATAAGGCAGCATGTCAGCTGAAACACCAATCACATTGAATATCGATCCTCAGGATCTGC
AGGTCCAAACATTCACCGTGGAGAAGCTACTGGAGCCTCTCATAATCCAGGTTACCACAC
TTGTAAACTGTCCCCAGAACCCTTCCAGCAGGAAAAAAGGACGTTCGAAAAGAGCCAGTG
TCCTTCTAGCTTCTGTGGAGGAAGCAACTTGGAATTTATTAGACAAGGGAGAGAAGATTG
CCCAGGAAGCTACAGTTTTAAAGGATGAGCTTACGGCTTCACTTGAGGAAGTTCGCAAAG
AAAGTGAAGCTCTGAAAGTATCAGCTGAGAGATTTACAGATGACCCCTGTTTTCTCCCAA
AAAGGGAGGCTGTGGTTCAAGCTGCCCGTGCCTTGCTGGCTGCGGTGACGAGACTCCTTA
TCCTTGCGGACATGATTGATGTCATGTGCCTCTTGNCACATGTGTCAGCTTTTCAAGGAC
ATTTGAGTCTCTCAAAATGTTGCCACAAATCTGACCTCCAGAAACCTACCAGAGCTTGGG
AAGAGCTGGAAAATTGGATTATTTAGCCTTCAACGTCAGCAGGACTTAAAATCTCCCAAT
CAGAAAGATGAATTTGCAGGAGCCCCGAGCTCCACTGGAAGAGGAACTTTCCCCTCTTGG
CATTCAATTTGTTCCAACTTGTTTGGGAGCATTTCTGATGGTGGCTTCCCTAAAAACAGC
AAGAACACATTTTGGAAAAAATTCAAAATGCTTTCA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_013266 unedited
TGGCTTTCATTTATAAGAACGTTTTAAAATCACTCCAGCTTCATTGCCATTAACTGCTTC
ATAGTTCAATGGTACAGTTCATGCAGTTATATTTTACTCAACGTCAAAAGGTTTTTCAAA
CTGCCATTTTCCTTTTAATTACAATTGCAAGCTGATAAAAATGTATTTTTATGTTTGTAA
AAATAGGGTCATACAGAACTTACACTTCTGTTATTATTAATATAACTCACTTTGGGATAT
AGTTTGTTGTCTCATTTTCCCAATGGGTGATAACTCTTCTTTCACATATGTATTCGGATA
GGCCTAACACTCAAAAGTACAGAACTCTCTAACACATTGGAAACCCAAAAGGTGAGTATG
TGGCATCATAACTCATTGCAACCTTTATAATGTTAAGAAAGCATATTATTAATAAACAAG
GTTGACCTTCAAAATCCAGCAAGTAGCCTAACTATTCAAATCTCACTAGGCTATCATGGA
TATTACCCTATAAGTTGACTATGACTACATGTATTCATAGATTTAAATGGTGGTTTTTCT
GCTATGCACGAATCCTACCTTTCTTCCTTGTTAAGTAGCCAATTACATCTAATAATACAC
CTGTCGATTAACTGTACATTCTTTACTAACGTCTTTGTTCTATTTCACCCCAGCTTTTAT
TTTCTTTATCGCACCATCCCCCCCACGTCCTCTTCCTCCTAATTCTCCTCCGCTCTTGGC
TCCCCCTCTTTTTCCTTATACATTTTATCCTAATTTCCCTTTCGCCTCCATCACATCCTT
ATTCCCCTACTAGCTTTTCCTCCTTCCCGTATTTTTTTTTCTCTCACCCGCACCTTTTTT
TTATTTCAATCTCTCCCTCACTCCTATCAGTACCGTCACCTATTTATTTCCCCACTTTTA
TTTATTCTCTTCNAAANACATCGCGCCTCTCCCCCATTTCTACTATTTTTCCGCTCTCCT
CGTCTTATCCTCACCACTTCATATTTCTTACCTACG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_013266
ORF Size 2688 bp
Insert Size 4000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_013266.1, NP_037398
RefSeq Size 3024
Locus ID 29119
Cytogenetics 10q21.3
Domains Vinculin
Protein Pathways Adherens junction, Tight junction, Leukocyte transendothelial migration, Pathways in cancer, Endometrial cancer, Arrhythmogenic right ventricular cardiomyopathy (ARVC)
Gene Summary This gene encodes a protein that belongs to the vinculin/alpha-catenin family. The encoded protein plays a role in cell-cell adhesion in muscle cells. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia, familial 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.