Apc2(ANAPC2) (NM_013366) Human Untagged Clone

CAT#: SC115268

ANAPC2 (untagged)-Human anaphase promoting complex subunit 2 (ANAPC2)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Apc2(ANAPC2) (NM_013366) Human Untagged Clone
Symbol ANAPC2
Synonyms APC2; APC2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC115268 sequence for NM_013366 edited (data generated by NextGen Sequencing)
ATGGCGGCGGCAGTTGTGGTGGCGGAGGGGGACAGCGACTCCCGGCCCGGACAGGAGTTG
TTAGTGGCCTGGAACACCGTGAGCACCGGCCTGGTGCCGCCGGCTGCGCTGGGGCTGGTG
TCTTCCCGGACCAGCGGTGCAGTCCCGCCAAAGGAAGAGGAGCTCCGGGCGGCGGTGGAG
GTTCTGAGGGGCCACGGGCTACACTCGGTCCTGGAGGAGTGGTTCGTGGAGGTGCTGCAG
AACGATCTGCAGGCCAACATCTCCCCTGAGTTCTGGAATGCCATCTCCCAATGCGAGAAC
TCTGCGGATGAGCCCCAGTGCCTTTTGCTACTCCTTGACGCTTTTGGCCTGCTGGAGAGC
CGCCTGGATCCCTACCTGCGTAGCCTAGAGCTGCTGGAGAAATGGACTCGCCTGGGCTTG
CTGATGGGCACTGGTGCTCAGGGGCTGCGAGAAGAAGTCCACACTATGTTGCGCGGAGTC
TTGTTCTTTAGCACCCCCAGAACCTTCCAAGAGATGATCCAGCGTCTGTATGGGTGCTTC
TTGAGAGTCTATATGCAGAGTAAGAGGAAGGGGGAAGGGGGCACAGACCCGGAACTGGAA
GGGGAGCTGGACAGCCGGTATGCCCGTCGCCGGTACTACCGGCTCCTGCAGAGCCCGCTG
TGTGCAGGGTGCAGCAGTGACAAGCAACAGTGCTGGTGTCGCCAGGCTCTGGAGCAGTTC
CATCAGCTCAGCCAGGTCTTACACAGGCTCAGTCTGCTGGAGCGGGTCAGTGCCGAGGCT
GTGACCACCACCCTGCACCAGGTGACCCGGGAGAGGATGGAGGACCGTTGCCGGGGCGAG
TACGAGCGCTCCTTCCTGCGTGAGTTCCACAAGTGGATCGAGCGGGTGGTCGGCTGGCTC
GGCAAGGTGTTCCTGCAGGACGGCCCCGCCAGGCCCGCATCTCCCGAGGCCGGCAACACC
CTGCGCCGCTGGCGCTGCCACGTGCAAAGGTTCTTCTACCGCATCTACGCCAGCCTGCGC
ATCGAGGAGCTCTTCAGCATCGTCCGAGACTTCCCAGACTCCCGGCCAGCCATCGAGGAC
CTCAAGTACTGCCTGGAGAGGACGGACCAGAGGCAGCAGCTGCTCGTGTCCCTCAAGGCT
GCCCTGGAGACTCGGCTCCTGCATCCAGGCGTCAACACGTGTGACATCATCACCCTCTAT
ATCTCTGCCATCAAGGCGCTGCGCGTGCTGGACCCTTCCATGGTCATCCTGGAGGTGGCC
TGTGAGCCTATCCGCCGCTACCTGAGGACGCGGGAGGACACAGTGCGGCAGATTGTGGCT
GGGCTGACGGGGGACTCGGACGGGACAGGGGACCTGGCTGTTGAGCTGTCCAAGACCGAC
CCGGCGAGCCTGGAGACAGGCCAGGACAGTGAGGATGACTCAGGCGAGCCAGAGGACTGG
GTCCCGGACCCTGTGGATGCCGATCCAGGGAAGTCGAGCTCCAAGCGGCGTTCATCGGAC
ATCATCAGCCTGCTGGTCAGCATCTACGGCAGCAAGGACCTCTTCATCAATGAGTACCGC
TCGCTGCTGGCCGACCGCCTGCTGCACCAGTTCAGCTTCAGCCCCGAGCGGGAGATCCGC
AACGTGGAGCTGCTGAAGCTGCGCTTTGGCGAGGCCCCAATGCACTTCTGTGAAGTCATG
CTGAAGGACATGGCGGACTCCCGCCGCATCAATGCCAACATCCGGGAGGAGGATGAGAAG
CGGCCAGCAGAGGAGCAGCCACCGTTCGGGGTCTACGCTGTCATCCTGTCCAGTGAGTTC
TGGCCGCCCTTCAAGGACGAGAAGCTGGAGGTCCCCGAGGATATCAGGGCAGCCCTGGAG
GCTTACTGCAAGAAGTATGAGCAGCTCAAGGCCATGCGGACCCTCAGTTGGAAGCACACC
CTGGGCCTGGTGACCATGGACGTGGAGCTGGCCGACCGCACGCTGTCTGTGGCGGTCACC
CCAGTACAGGCGGTGATCTTGCTGTATTTTCAGGACCAAGCCAGCTGGACCCTGGAGGAA
CTGAGCAAGGCGGTGAAGATGCCCGTGGCGCTGCTGCGGCGGCGGATGTCCGTGTGGCTG
CAGCAGGGTGTGCTGCGTGAGGAGCCCCCCGGCACCTTCTCTGTCATTGAGGAGGAGCGG
CCTCAGGACCGGGACAACATGGTGCTCATTGACAGTGACGACGAGAGCGACTCCGGCATG
GCCTCCCAGGCCGACCAGAAGGAGGAGGAGCTGCTGCTCTTCTGGACGTACATCCAGGCC
ATGCTGACCAACCTGGAGAGCCTCTCACTGGATCGTATCTACAACATGCTCCGCATGTTT
GTGGTGACTGGGCCTGCACTGGCCGAGATTGACCTGCAGGAGCTGCAGGGCTACCTGCAG
AAGAAGGTGCGGGACCAGCAGCTCGTCTACTCGGCCGGCGTCTACCGCCTGCCCAAGAAC
TGCAGCTGA

Clone variation with respect to NM_013366.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_013366 unedited
TTGAGGGATTTTGGAATACGATCTCACTATAGGGCGGCCGCGAATTCGCACGAGGCGCCG
AGCGAATCTCGGAGTCGGTGGGTGCAGATGGCGGCGGCAGTTGTGGTGGCGGAGGGGGAC
AGCGACTCCCGGCCCGGACAGGAGTTGTTAGTGGCCTGGAACACCGTGAGCACCGGCCTG
GTGCCGCCGGCTGCGCTGGGGCTGGTGTCTTCCCGGACCAGCGGTGCAGTCCCGCCAAAG
GAAGAGGAGCTCCGGGCGGCGGTGGAGGTTCTGAGGGGCCACGGGCTACACTCGGTCCTG
GAGGAGTGGTTCGTGGAGGTGCTGCAGAACGATCTGCAGGCCAACATCTCCCCTGAGTTC
TGGAATGCCATCTCCCAATGCGAGAACTCTGCGGATGAGCCCCAGTGCCTTTTGCTACTC
CTTGACGCTTTTGGCCTGCTGGAGAGCCGCCTGGATCCCTACCTGCGTAGCCTAGAGCTG
CTGGAGAAATGGACTCGCCTGGGCTTGCTGATGGGCACTGGTGCTCAGGGGCTGCGAGAA
GAAGTCCACACTATGTTGCTCGGAGTCTTGTTCTTTAGCACCCCCAGAACCTTCCAAGAG
ATGATCCAGCGTCTGTATGGGTGCTTCTTGAGAGTCTATATGCAGAGTAAGAGGAAGGGG
GAAGGGGGCACAGACCCGGGACTGGAAGGGGAGCTGGACCAGCCGTTTGCCCGTCGCCCG
TACTACCGACTCCTGCAGAGCCCGCTGTGTGCAGGCTGCCACATTGACCAACCACAGTGC
TGGGTGTCGCCAGCTCTGGAGCAGTTCCTCAGCTTAACCAGGTCTTACACAGGCTAATTC
TGCTGGAACAGCTCAATGCCGCAGCTTGGACCCCACCCTTGGACCAGTGACCCGGTGAAA
GGATGAAGGAACCTTTGCCGGGGCGAGATCCAACCTTCCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_013366 unedited
GCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGATGATCTGACTTGCTTTAATCT
GCACACTGCGGGGGTGGGGGTGGGCATGCTCCTCAGCAGTGCATTCTGGGACACGGGCGG
GCGGGGGCTGGCACGGGAGGACGAGAGCACCTGCAGGGCAGCGCCTGGCGGGCGGGCGGG
CGGGCGGGCGATGTGTCAGCTGCAGTTCTTGGGCAGGCGGTAGACGCCGGCCGAGTAGAC
GAGCTGCTGGTCCCGCACCTTCTTCTGCAGGTAGCCCTGCAGCTCCTGCAGGTCAATCTC
GGCCAGTGCAGGCCCAGTCACCACAAACATGCGGAGCATGTTGTAGATACGATCCAGTGA
GAGGCTCTCCAGGTTGGTCAGCATGGCCTGGATGTACGTCCAGAAGAGCAGCAGCTCCTC
CTCCTTCTGGTCGGCCTGGGAGGCCATGCCGGAGTCGCTCTCGTCGTCACTGTCAATGAG
CACCATGTTGTCCCGGTCCTGAGGCCGCTCCTCCTCAATGACAGAGAAGGTGCCGGGGGG
CTCCTCACGCAGCACACCCTGCTGCAGCCACACGGACATCCGCCGCCGCAGCAGCGCCAC
GGGCATCTTCACCGCCTTGCTCAGTTCCTCCAGGGTCCAGCTGGCTTGGTCCTGAAAATA
CAGCAAGATCACCGCCTGTACTGGGGTGACCGCACAGACAGCGTGCGGTCGGCCAGCTCC
ACGTCCATGTCCACAGGCCCAGGTGTGCTTCCAACTGAGTCCGCATGCCCTGAGCTGCTA
TACTTCTGCAGTAGCCTCAGGCCTGCCTGAATCCTGGGGACTCCACTTTCGTCCTGAGGC
CGGCCNACTACTTCCAGAGACAGGTAACCCCAACGTGGTGTCCTTGTTGCCGGTTATCTT
CTCGGATGTGCTTGAGCGCGGAGTCCCAGTCTTAATGATTCACAAGCCTGGCTCCCN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_013366
ORF Size 2469 bp
Insert Size 2800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_013366.3, NP_037498
RefSeq Size 2733
Locus ID 29882
Cytogenetics 9q34.3
Domains CULLIN
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Ubiquitin mediated proteolysis, Progesterone-mediated oocyte maturation
Gene Summary A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The product of this gene is a component of the complex and shares sequence similarity with a recently identified family of proteins called cullins, which may also be involved in ubiquitin-mediated degradation. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.