PD L1(CD274) (NM_014143) Human Untagged Clone

CAT#: SC115168

PD-L1 / CD274 (untagged)-Human PD-L1 / CD274 molecule (PD-L1 / CD274)

 Cited in 2 publications.

  View "NM_014143" in other vectors (10)

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name PD L1(CD274) (NM_014143) Human Untagged Clone
Symbol CD274
Synonyms B7-H; B7H1; PD-L1; PDCD1L1; PDCD1LG1; PDL1
Vector pCMV6-XL4
Sequence Data
>OriGene ORF within SC115168 sequence for NM_014143 edited (data generated by NextGen Sequencing)
ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCATTTACT
GTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGC
AAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAG
GATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGC
TACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAG
ATCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGT
GCCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCATACAACAAAATCAACCAAAGA
ATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGCTAC
CCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTCCTGAGTGGTAAGACCACC
ACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACCAGCACACTGAGAATCAAC
ACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTAGATCCTGAGGAAAACCAT
ACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCTCCAAATGAAAGGACTCAC
TTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCACTGACATTCATCTTCCGT
TTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATCCAAGATACAAACTCAAAG
AAGCAAAGTGATACACATTTGGAGGAGACGTAA

Clone variation with respect to NM_014143.3
>OriGene 5' read for NM_014143 unedited
CGGGCCCCNNNNCCCCAACCNCCCCCGGTTCAAATTTGTATACGACTCACTATAGGCGGC
CGCGAATTCGCACGAGGCACCAGCCGCGCTTCTGTCCGCCTGCAGGGCATTCCAGAAAGA
TGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCATTTACTG
TCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCA
AATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAGG
ATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCT
ACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGNGAAATGCTGCACTTCAGA
TCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGTG
CCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCATACAACAAAATCAACCAAAGAA
TTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACATGTCANGCTGANGGCTACC
CCAAGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTCCTGAGTGGTAAGACCACCAC
CACCAATTCCAAGAGAGAGGAGAAGCTTTTCATGTGACCACACACTGAGAAATCACACAN
NCACTATGAGATTTTCTACTGCACTTTTANGAGAATAGATCCCTGAGAAAACATACAGCT
GAATTGGTCATCCCAGAACTACCTCTGGCACATTCTTCAATGAAAGGACTCACTTGGTAA
TNCTGGGAGCCATCCTATTATGCCCTTGGTGTAACACTGACATTCATTTTTNCGTTTAAG
AAAGGNAGAATGATGNATGTGAAAAAATGTGCATNCCAGATACAANACTCAAGAAGCAAG
TGATACACATTGGNAGGANACAGTATCCAGCATTGGAACTTCTGATCTTCAAGCGGGATN
CTCAACCTGGG
>OriGene 3' genomic read for NM_014143 unedited
TCGACCATGGAATGGCAACTTCCAGGNCCAGNAAAGCACTGGGGNAGGGTCACAGGGATG
CCACCCGGGTTCTGTTCAGGAAAAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACCAAGTAACAAAATAAATAAAAATATT
TTATTAAATTAATGCAGGTACAAAAAGTGACAATCAAATGCAAAATTAGGTATCATCTCT
GCCTATGCCATTTACGATGAAACATGAGACAAAAGGGATAAAGTGCCTTACAAATCCAAC
ACCACAGGGAGGAGTTAGGACTTAGGAATAGACTGAGTAGACTATGTGCCTTGCTCAGCC
ACAATTCTTGCCTGTAATTCACACAAAGAACACTGTCACACCAATTACTGTACAAATGCA
CATGTACAAACAGATAACACAAGGAGCTCTGTTGGAGACACTGTTTCTTCAGCCTTGACA
TGTGGCAAAGCCAAGGTACTCCTTGTCATTGACACCAGAATATGGCCAAGAGGGAAAGGA
AACTCTGGGATCTCCCAGGGCATCTGAATCTCGAAACCTCCAGGAAGCCTCTTAAGAGGG
CTGTGTAGTGATGACAGCTGGTGGCATTCAAGGGTTCAAGCACAACGAATGAGGCTTTTC
TGGCACAGGGTAGCTAGCAGTCAAGGTACACTGCCGGAATTTCCAGAAAGAAAATGTGAT
TTTGCAAGTACAGCATCAAAGTGAAGTTTATACTTGACAGAAAGCAGAAAACAAAAGTTC
CAGACATGATTCTGTCATACAGAGTTAATAATAAGATTGCTTTTTAGGACTAGATTGACT
CAGTGCACCCTGGAGAGCCCATGGGTCTCCTTTTGAGCAACATAACAAATCCAACTCTGT
CCTAGACAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_014143
ORF Size 873 bp
Insert Size 4000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_014143.2, NP_054862
RefSeq Size 1553
RefSeq ORF 873
Locus ID 29126
Cytogenetics 9p24.1
Domains ig, IG
Protein Families Transmembrane, Druggable Genome
Protein Pathways Cell adhesion molecules (CAMs)
Gene Summary This gene encodes an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Expression of this gene in tumor cells is considered to be prognostic in many types of human malignancies, including colon cancer and renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a).

Citations (2)

Other Versions

Other products for "PD-L1 (CD274)"
Frequently bought together (2)
PD-L1 / CD274 mouse monoclonal antibody, clone OTI2C7 (formerly 2C7)
    • 100 ul

USD 360.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 Vial

USD 430.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies