UQCRQ (NM_014402) Human Untagged Clone

CAT#: SC115007

UQCRQ (untagged)-Human ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa (UQCRQ), nuclear gene encoding mitochondrial protein

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name UQCRQ (NM_014402) Human Untagged Clone
Symbol UQCRQ
Synonyms MC3DN4; QCR8; QP-C; QPC; UQCR7
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_014402, the custom clone sequence may differ by one or more nucleotides


ATGGGCCGCGAGTTTGGGAATCTGACGCGGATGCGGCATGTGATCAGCTACAGCTTGTCACCGTTCGAGC
AGCGCGCCTATCCGCACGTCTTCACTAAAGGAATCCCCAATGTTCTGCGCCGCATTCGGGAGTCTTTCTT
TCGCGTGGTGCCGCAGTTTGTAGTGTTTTATCTTATCTACACATGGGGGACTGAAGAGTTCGAGAGATCC
AAGAGGAAGAATCCAGCTGCCTATGAAAATGACAAATGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_014402 unedited
NNGGTTGGAATTTGGNATACGACTCACTATAGGCGGCCGGCGATTCGGCACGAGGGACGA
ACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATG
GGCCGCGAGTTTGGGAATCTGACGCGGATGCGGCATGTGATCAGCTACAGCTTGTCACCG
TTCGAGCAGCGCGCCTATCCGCACGTCTTCACTAAAGGAATCCCCAATGTTCTGCGCCGC
ATTCGGGAGTCTTTCTTTCGCGTGGTGCCGCAGTTTGTAGTGTTTTATCTTATCTACACA
TGGGGGACTGAAGAGTTCGAGAGATCCAAGAGGAAGAATCCAGCTGCCTATGAAAATGAC
AAATGAGCAACGCATCCGGATGACGGTTCCCTGTCTCTGAAAGACCTTTCTCTGGAAGAG
GAGTCTGCATTGTAGTGTCTCAAAGACACAATAAACTTCCTATGGTCTGCAAAAAAAAAA
AAAAAAAACTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGG
GTGGCATCCCTGTGACCCCTCCCCAGTGCCCTTTCCTGGCCCTGGAAGCTGCCACTCCAG
TGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGCCTGACTAGGCGTCCT
TCTATAATATTATGGGGTGGAGGGGGGTGGGATTGAATTATGTATCAAAACTGTTAATAT
TATCTGTAAGGCTTGTTGTTCTTCTTGGATACAAATTTGATTTTTACGTACACAAATTCC
TATCTTCCATTTTTCGTCTTAAGTTTCAATTACTTTTTCTGCTTTTCTTTACCATTTATA
TTTATTACTTATCTTCTATAAATAAATTTTTTTTATCTAATATTATATTTTATTAATTT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_014402 unedited
NTTTAGCTCTGGACCGGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTGCAG
ACCATAGGAAGTTTATTGTGTCTTTGAGAACACTACAATGCAGACTCCTCTTCCAGAGAA
AGGTCTTTCAGAGACAGGGAACCGTCATCCGGATGCGTTGCTCATTTGTCATTTTCATAG
GCAGCTGGATTCTTCCTCTTGGATCTCTCGAACTCTTCAGTCCCCCATGTGTAGATAAGA
TAAAACACTACAAACTGCGGCACCACGCGAAAGAAAGACTCCCGAATGCGGCGCAGAACA
TTGGGGATTCCTTTAGTGAAGACGTGCGGATAGGCGCGCTGCTCGAACGGTGACAAGCTG
TAGCTGATCACATGCCGCATCCGCGTCAGATTCCCAAACTCGCGGCCCATTGTGGCGGCG
GCCAGGGCTCAGCTCGCCCTCCACAGTCACCGATCCGGTTGACTCGTTCGTCCCTCGTGC
CGAATTCGCGGCCGCCCTATAGTGAGTCGTATTACAAAATTCTGACGGTTCACTAAACGA
GCTCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAACGGGGCG
GGGTTATTACGACATTNTGGAAAGTCCCGTTGATTTTGGTGCCAAAACANACTCCCATTG
ACGTCAATGGGGTGGAGACTGGNAAATCCCGTGAGTCAACCGCTATCACGCCCATTGGTG
ACTGCCAAACCGCATCACCATGGTATAGCGATGACTATACGTANATGTACTGCCAAGTAG
GAAAGTCCCGTAGGTCATGTACTGGGCATAATGCCAGCCGGCCATTTACCGCATTGACGT
CCATAGGGGCCGGCTNGCCATATGAACACTGGAGTACCTGCCAGTGGCCAGTTACCGTAA
TACTC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_014402
ORF Size 282 bp
Insert Size 460
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_014402.2, NP_055217
RefSeq Size 388
Locus ID 27089
Cytogenetics 5q31.1
Domains UcrQ
Protein Pathways Oxidative phosphorylation, Metabolic pathways, Cardiac muscle contraction, Alzheimer's disease, Parkinson's disease, Huntington's disease
Gene Summary This gene encodes a ubiquinone-binding protein of low molecular mass. This protein is a small core-associated protein and a subunit of ubiquinol-cytochrome c reductase complex III, which is part of the mitochondrial respiratory chain. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.