N acetyl transferase 5 (NAA20) (NM_016100) Human Untagged Clone

CAT#: SC114456

Reviews ()
Write a review

NAA20 (untagged)-Human N(alpha)-acetyltransferase 20, NatB catalytic subunit (NAA20), transcript variant 1


Product Datasheet for 'SC114456'


  "NM_016100" in other vectors (6)

Need a mutant or fragment? Switch to a different vector? Get a free quote.

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name N acetyl transferase 5 (NAA20) (NM_016100) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol NAA20
Synonyms dJ1002M8.1; NAT3; NAT3P; NAT5; NAT5P
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC114456 sequence for NM_016100 edited (data generated by NextGen Sequencing)
ATGACCACGCTACGGGCCTTTACCTGCGACGACCTGTTCCGCTTCAACAACATTAACTTG
GATCCACTTACAGAAACTTATGGGATTCCTTTCTACCTACAATACCTCGCCCACTGGCCA
GAGTATTTCATTGTTGCAGAGGCACCTGGTGGAGAATTAATGGGTTATATTATGGGTAAA
GCAGAAGGCTCAGTAGCTAGGGAAGAATGGCACGGGCACGTCACAGCTCTGTCTGTTGCC
CCAGAATTTCGACGCCTTGGTTTGGCTGCTAAACTTATGGAGTTACTAGAGGAGATTTCA
GAAAGAAAGGGTGGATTTTTTGTGGATCTCTTTGTAAGAGTATCTAACCAAGTTGCAGTT
AACATGTACAAGCAGTTGGGCTACAGTGTATATAGGACGGTCATAGAGTACTATTCGGCC
AGCAACGGGGAGCCTGATGAGGACGCTTATGATATGAGGAAAGCACTTTCCAGGGATACT
GAGAAGAAATCCATCATACCATTACCTCATCCTGTGAGGCCTGAAGACATTGAATAA

Clone variation with respect to NM_016100.4
>OriGene 5' read for NM_016100 unedited
TAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACCAGGCCTCGTGCCGATTCGGCA
CGAGGGTCTTCGGAAGCGGCGGCGGCGCGATGACCACGCTACGGGCCTTTACCTGCGACG
ACCTGTTCCGCTTCAACAACATTAACTTGGATCCACTTACAGAAACTTATGGGATTCCTT
TCTACCTACAATACCTCGCCCACTGGCCAGAGTATTTCATTGTTGCAGAGGCACCTGGTG
GAGAATTAATGGGTTATATTATGGGTAAAGCAGAAGGCTCAGTAGCTAGGGAAGAATGGC
ACGGGCACGTCACAGCTCTGTCTGTTGCCCCAGAATTTCGACGCCTTGGTTTGGCTGCTA
AACTTATGGAGTTACTAGAGGAGATTTCAGAAAGAAAGGGTGGATTTTTTGTGGATCTCT
TTGTAAGAGTATCTAACCAAGTTGCAGTTAACATGTACAAGCAGTTGGGCTACAGTGTAT
ATAGGACGGTCATAGAGTACTATTCGGCCAGCAACGGNGAGCCTGATGAGGACGCTTATG
ATATGAGGAAAGCACTTTCCAGGGATACTGAGAAGAAATCCATCATACCATTACCTCATC
CTGTGAGGCCTGAAGACATTGAATAACCCTGGGCAGTGGTTCTTAGGCAGATACTCTAGA
TGCTTTATGGACAATATTATTTTCATTGGATGATTCTGGAGCTCTATTANGAGAAAAAGT
ATCATTTTAGGTCTTAAAGACTTCAGAAAATACAGGTTATCAATNTATTNTAAATCTCAT
TGTTTCCAGTTAGCAATATCATACCTATTNAAGCTGTTCATTGGTACANAATNNNCATCA
AAAGCCAGCTAGTCAGAAGGAAACATACACTCTCATGGTNATAGAATCACTGTATGTATG
CTAGGGAAAAGACTGCTCCATCTCCCTCTCAGTCTG
>OriGene 3' read for NM_016100 unedited
GCAATCTAGTATCGAGTTCTTTTTTTTTTTTTTTTTTTTTTAGAGTCAATAATGTATTAT
ACATCTTAAATTTATACATTTCATATATGCTTTTAAAGCTTCAATTAACAGTTCAATACA
AAATTTAAAAACAAATATATGCAGCAGTGGTTCTCAGGCACAGAACTGAGGAGGAGACTG
GAGCAAGTCTTTTCCCTAGCATACATACAGTGAATACTATGAACCATGAGAGTGGTATGT
TTCCTTCTGACCTAGCTGCCTTTTTGATTGAATTTTGTTACAATGAACAGCTTTAATAGG
TATGATATTGCTAACTGGAAACAATGAGATTTAAAATAAATTGATAACCTGTATTTTCTT
GAAGTCTTTAAGACCTAAAATGATTACTTTTCTCCTAATAGAGCTCCAGAATCATCCAAT
GAAAATAATATTGTCCATAAAGCATCTAGAGTATCTGCCTAAGAACCACTGCCCAGGGTT
ATTCAATGTCTTCAGGCCTCACAGGATGAGGTAATGGTATGATGGATTTCTTCTCAGTAT
CCCTGGAAAGAGCTTTCCTCATATCATAAGCGTCCTCATCAGGCTCCCCGTTGCTGGCCG
AATAGTACTCTATGACCGTCCTATATACACTGTAGCCCAACTGCTNGTACATGTTAACTG
CAACTTGGTTAGATACTCTTTTACAAGAGATCCACAAAAATCCACCCCTTTCTTTCTGAA
ATCTCCTCTAGTAACTCCATAAGTTTAGCAGCCCAACCAAGGCGTTGAAAATCCTGGGCA
ACAGACAGAGCTGTGACGTGCCCGTGCATTTTTTCCTACTACTGAGCCTTCTGCTTAACC
ATAATATACCCTTAATTCTCACCAGGTGCTCTGCACATGAAATACTCTGCCAGGGGCCAG
TATTGTAGAAAAGGATCCCTAAGTTCGTAATGGATCATTAATGTGTGACCGACACGTCTC
CAAGTAAGCCCTACGGGTATCCCCCCCCCGCTTCAAAACTC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_016100
Insert Size 1070 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016100.2, NP_057184.1
RefSeq Size 1360 bp
RefSeq ORF 537 bp
Locus ID 51126
Cytogenetics 20p11.23
Domains Acetyltransf
Protein Pathways Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
Gene Summary NAT5 is a component of N-acetyltransferase complex B (NatB). Human NatB performs cotranslational N(alpha)-terminal acetylation of methionine residues when they are followed by asparagine (Starheim et al., 2008 [PubMed 18570629]).[supplied by OMIM, Apr 2009]
Transcript Variant: This variant (1) encodes the longest isoform (a).

Other Versions

Other products for "NAA20"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools