CACNA2D3 (NM_018398) Human Untagged Clone

CAT#: SC113489

CACNA2D3 (untagged)-ORIGENE UNIQUE VARIANT 1 of Human calcium channel, voltage-dependent, alpha 2/delta subunit 3 (CACNA2D3)

USD 1,041


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CACNA2D3 (NM_018398) Human Untagged Clone
Symbol CACNA2D3
Synonyms HSA272268
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_018398, the custom clone sequence may differ by one or more nucleotides


ATGGCCGGGCCGGGCTCGCCGCGCCGCGCGTCCCGGGGGGCCTCGGCGCTTCTCGCTGCCGCGCTTCTCT
ACGCCGCGCTGGGGGACGTGGTGCGCTCGGAGCAGCAGATACCGCTCTCCGTGGTGAAGCTCTGGGCCTC
GGCTTTTGGTGGGGAGATAAAATCCATTGCTGCTAAGTACTCCGGTTCCCAGCTTCTGCAAAAGAAATAC
AAAGAGTATGAGAAAGACGTTGCCATAGAAGAAATCGATGGCCTCCAACTGGTAAAGAAGCTGGCAAAGA
ACATGGAAGAGATGTTTCACAAGAAGTCTGAGGCCGTCAGGCGTCTGGTGGAGGCTGCAGAAGAAGCACA
CCTGAAACATGAATTTGATGCAGACTTACAGTATGAATACTTCAATGCTGTGCTGATAAATGAAAGGGAC
AAAGACGGGAATTTTTTGGAGCTGGGAAAGGAATTCATCTTAGCCCCAAATGACCATTTTAATAATTTGC
CTGTGAACATCAGTCTAAGTGACGTCCAAGTACCAACGAACATGTACAACAAAGACCCTGCAATTGTCAA
TGGGGTTTATTGGTCTGAATCTCTAAACAAAGTTTTTGTAGATAACTTTGACCGTGACCCATCTCTCATA
TGGCAGTACTTTGGAAGTGCAAAGGGCTTTTTTAGGCAGTATCCGGGGATTAAATGGGAACCAGATGAGA
ATGGAGTCATTGCCTTCGACTGCAGGAACCGAAAATGGTACATCCAGGCAGCAACTTCTCCGAAAGACGT
GGTCATTTTAGTTGACGTCAGTGGCAGCATGAAAGGACTCCGTCTGACTATCGCGAAGCAAACAGTCTCA
TCCATTTTGGATACACTTGGGGATGATGACTTCTTCAACATAATTGCTTATAATGAGGAGCTTCACTATG
TGGAACCTTGCCTGAATGGAACTTTGGTGCAAGCCGACAGGACAAACAAAGAGCACTTCAGGGAGCATCT
GGACAAACTTTTCGCCAAAGGAATTGGAATGTTGGATATAGCTCTGAATGAGGCCTTCAACATTCTGAGT
GATTTCAACCACACGGGACAAGGAAGTATCTGCAGTCAGGCCATCATGCTCATAACTGATGGGGCGGTGG
ACACCTATGATACAATCTTTGCAAAATACAATTGGCCAGATCGAAAGGTTCGCATCTTCACATACCTCAT
TGGACGAGAGGCTGCGTTTGCAGACAATCTAAAGTGGATGGCCTGTGCCAACAAAGGATTTTTTACCCAG
ATCTCCACCTTGGCTGATGTGCAGGAGAATGTCATGGAATACCTTCACGTGCTTAGCCGGCCCAAAGTCA
TCGACCAGGAGCATGATGTGGTGTGGACCGAAGCTTACATTGACAGCACTCTCCCTCAGGCACAAAAGCT
GACTGATGATCAGGGCCCCGTCCTGATGACCACTGTAGCCATGCCTGTGTTTAGTAAGCAGAACGAAACC
AGATCGAAGGGCATTCTTCTGGGAGTGGTTGGCACAGATGTCCCAGTGAAAGAACTTCTGAAGACCATCC
CCAAATACAAGTTAGGGATTCACGGTTATGCCTTTGCAATCACAAATAATGGATATATCCTGACGCATCC
GGAACTCAGGCTGCTGTACGAAGAAGGAAAAAAGCGAAGGAAACCTAACTATAGTAGCGTTGACCTCTCT
GAGGTGGAGTGGGAAGACCGAGATGACGTGTTGAGAAATGCTATGGTGAATCGAAAGACGGGGAAGTTTT
CCATGGAGGTGAAGAAGACAGTGGACAAAGGGAAACGGGTTTTGGTGATGACAAATGACTACTATTATAC
AGACATCAAGGGTACTCCTTTCAGTTTAGGTGTGGCGCTTTCCAGAGGTCATGGGAAATATTTCTTCCGA
GGGAATGTAACCATCGAAGAAGGCCTGCATGACTTAGAACATCCCGATGTGTCCTTGGCAGATGAATGGT
CCTACTGCAACACTGACCTACACCCTGAGCACCGCCATCTGTCTCAGTTAGAAGCGATTAAGCTCTACCT
AAAAGGCAAAGAACCTCTGCTCCAGTGTGATAAAGAATTGATCCAAGAAGTCCTTTTTGACGCGGTGGTG
AGTGCCCCCATTGAAGCGTATTGGACCAGCCTGGCCCTCAACAAATCTGAAAATTCTGACAAGGGCGTGG
AGGTTGCCTTCCTCGGCACTCGCACGGGCCTCTCCAGAATCAACCTGTTTGTCGGGGCTGAGCAGCTCAC
CAATCAGGACTTCCTGAAAGCTGGCGACAAGGAGAACATTTTTAACGCAGACCATTTCCCTCTCTGGTAC
CGAAGAGCCGCTGAGCAGATTCCAGGGAGCTTCGTCTACTCGATCCCATTCAGCACTGGACCAGTCAATA
AAAGCAATGTGGTGACAGCAAGTACATCCATCCAGCTCCTGGATGAACGGAAATCTCCTGTGGTGGCAGC
TGTAGGCATTCAGATGAAACTTGAATTTTTCCAAAGGAAGTTCTGGACTGCCAGCAGACAGTGTGCTTCC
CTGGATGGCAAATGCTCCATCAGCTGTGATGATGAGACTGTGAATTGTTACCTCATAGACAATAATGGAT
TTATTTTGGTGTCTGAAGACTACACACAGACTGGAGACTTTTTTGGTGAGATCGAGGGAGCTGTGATGAA
CAAATTGCTAACAATGGGCTCCTTTAAAAGAATTACCCTTTATGACTACCAAGCCATGTGTAGAGCCAAC
AAGGAAAGCAGCGATGGCGCCCATGGCCTCCTGGATCCTTATAATGCCTTCCTCTCTGCAGTAAAATGGA
TCATGACAGAACTTGTCTTGTTCCTGGTGGAATTTAACCTCTGCAGTTGGTGGCACTCCGATATGACAGC
TAAAGCCCAGAAATTGAAACAGACCCTGGAGCCTTGTGATACTGAATATCCAGCATTCGTCTCTGAGCGC
ACCATCAAGGAGACTACAGGGAATATTGCTTGTGAAGACTGCTCCAAGTCCTTTGTCATCCAGCAAATCC
CAAGCAGCAACCTGTTCATGGTGGTGGTGGACAGCAGCTGCCTCTGTGAATCTGTGGCCCCCATCACCAT
GGCACCCATTGAAATCAGGTATAATGAATCCCTTAAGTGTGAACGTCTAAAGGCCCAGAAGATCAGAAGG
CGCCCAGAATCTTGTCATGGCTTCCATCCTGAGGAGAATGCAAGGGAGTGTGGGGGTGCGCCGAGTCTCC
AAGCCCAGACAGTCCTCCTTCTGCTCCCTCTGCTTTTGATGCTCTTCTCAAGGTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_018398 unedited
GGCACATTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGCACGAGGGCTCTGGGCCT
CGGCTTTTGGTGGGGAGATAAAATCCATTGCTGCTAAGTACTCCGGTTCCCAGCTTCTGC
AAAAGAAATACAAAGAGTATGAGAAAGACGTTGCCATAGAAGAAATCGATGGCCTCCAAC
TGGTAAAGAAGCTGGCAAAGAACATGGAAGAGATGTTTCACAAGAAGTCTGAGGCCGTCA
GGCGTCTGGTGGAGGCTGCAGAAGAAGCACACCTGAAACATGAATTTGATGCAGACTTAC
AGACCCTGCAATTGTCAATGGGGTTTATTGGTCTGAATCTCTAAACAAAGTTTTTGTAGA
TAACTTTGACCGTGACCCATCTCTCATATGGCAGTACTTTGGAAGTGCAAAGGGCTTTTT
TAGGCAGTATCCGGGGATTAAATGGGAACCAGATGAGAATGGAGTCATTGCCTTCGACTG
CAGGAACCGAAAATGGTACATCCAGGCAGCAACTTCTCCGAAAGACGTGGTCATTTTAGT
TGACGTCAGTGGCAGCATGAAAGGACTCCGTCTGACTATCGCGAAGCAAACAGTCTCATC
CATTTTGGATACACTTGGGGATGATGACTTCTTCAACATAATTGCTTATAATGAGGAGCT
TCACTATGTGGAACCTTGCCTGAATGGAACTTTGGTGCAAGCCGACAGGACAAACAAAGA
GCACTTCAGGGAGCATCTGGACAAACTTTTCGCCAAAGGAATTGGAATGTTGAATATAGC
TCTGAATGAGGCCTTCAACATTCTGAGTGATTTCAACCACACGGGACAGGNAATATCTGC
AGCACGGCCTCATGCTCATAACTGATGGGGCGGTTGGCACCTATGATCCATCCTTGCAAA
TACAATTGGCCAGATCA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_018398 unedited
GCGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTATGATTTTAATATACTTTAT
TTAAAAAGTACACAGTTTTAAATTGGTTTCAATAGGTTTCAAGCAGAAGGGACACTGCCT
ACCACTTGCGGTCCCATTTCTGATGAAGGGTGATTATCATGTGGCAAACTCACATTTGCA
TGACTGGCAAAGTAAAAAGATGATAGATAACTTTTTGTCAACATATCTTTAAGAGTTTAT
ATCACGCACAGTTTAAAATCATGATGAGATGCTGATGGTTGGACTATATTCATGTCTCGT
ATGTTGCACCATATTTTGGTTCACAGTTTATCCATGATTTAGCATGCCAAGAGAACATCT
CAGTCAGTAAGAGAACATCTCAGTCAGTGTCACCTTGAGAAGAGCATCAAAAGCAGAGGG
AGCAGAAGGAGGACTGTCTGGGCTTGGAGACTCGGCGCACCCCCACACTCCCTTGCATTC
TCCTCAGGATGGAAGCCATGACAAGATTCTGGGCGCCTTCTGATCTTCTGGGCCTTTAGA
CGTTCACACTTAAGGGATTCATTATACCTGATTTCAATGGGTGCCATGGTGATGGGGGCC
ACAGATTCACAGAGGCAGCTGCTGTCCACCACCACCATGAACAGGTTGCTGCTTGGGATT
TGCTGGATGACAAAGGACTTGGAGCAGTCTTCACAAGCAATATTTCCTGTAGTCTCCTTG
ATGGTGCGCTCAGAGACGAATGCTGGATATTCAGTATCACAAGGCTCCANGGGTCTGTTT
CAATTTCTGGGCTTTANNCTGTCATATCGGAGTGCCACCACCTGCAGAGGTTAAATTCCC
CAGGAACAAGACAAGTTCTGTCATGATCCTTTTACTGCAGAAAGGAAGCCTTATTAGGAT
CCCAGAGGCCATGGCGCCATCGCTGCTTTCCTTGTGGCTTCACAGGCCCAGTAANCATAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_018398
ORF Size 2994 bp
Insert Size 3410
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_018398.1, NP_060868
RefSeq Size 3689
RefSeq ORF 2994
Locus ID 55799
Cytogenetics 3p21.1-p14.3
Domains vwa, Cache
Protein Families Ion Channels: Other, Druggable Genome
Protein Pathways MAPK signaling pathway, Cardiac muscle contraction, Hypertrophic cardiomyopathy (HCM), Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy
Gene Summary This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.