Cytochrome C(CYCS) (NM_018947) Human Untagged Clone

CAT#: SC113344

CYCS (untagged)-Human cytochrome c, somatic (CYCS), nuclear gene encoding mitochondrial protein

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cytochrome C(CYCS) (NM_018947) Human Untagged Clone
Symbol CYCS
Synonyms CYC; HCS; THC4
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC113344 sequence for NM_018947 edited (data generated by NextGen Sequencing)
ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACC
GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAG
ACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
AAAGCTACTAATGAGTAA

Clone variation with respect to NM_018947.5
5' Read Nucleotide Sequence
>OriGene 5' read for NM_018947 unedited
CCGTCACATTTGTATACGATCATATAGGCGGCCGCGCAATTCGCACGAGGCCGGCTTCGG
AGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAACAGAATTAAATATGGGTGATGTTGAGA
AAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGGGAGGCA
AGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCCCCTG
GATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGGGGAGAGGATACACTGA
TGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATGATCTTTGTCGGCA
TTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAAAAAGCTACTAATGAGT
AATAATTGGCCACTGCCTTATTTATTACAAAACAGAAATGTCTCATGACTTTTTTATGTG
TACCATCCTTTAATAGATCTCATACACCAGAATTCAGATCATGAATGACTGACAGAATAT
TTTGTTGGGCAGTCCTGATTTAAAACTAAGACTGGCTTGTGGTTAAATGAATATGTTCAG
TTTTTGAATTTTAATAGTAACTCCAATTCAGTAAATGGTATCACTGTTTACCCCTTTTAA
AGATATGATTAGACTTCGTTAGTAATGTTCAACTTTTCACAAAGATGGTGAGTGCCATCT
TAAAACTTACTGGAGATTGGTTTTATATTTAGATTTATATAACTGGTTATGTGAATATAT
TTAAATACTGGGNGAAATTGCTTCACTGTCTTAGCACCAAAGCAGAATCACCTGTGTTNT
GGNGTCATGTTCATTTGCCTCTTAAGGCTAGGGTGCAGATAATAAGTACCAT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_018947 unedited
GGGCCAGGTAAGGCACTGGGGAGGGGTCACAGGATGCCACCCGGGATCTGTTCAGGAAAC
AGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTCATGATCTGT
GGTTTTCTTTTTAATTATCTTTAGTCTTGTGATCACACATAATTTTAAAATTTGTGTATA
TCTCCGTTACTTTAATCCTTTTAAGTTGGCAAAAGCACCATTCCCAATCAAATACACAGT
TCTACAGTTTTGTTTCTGAATGGCTGTTTAAAGACAATCCTAAATTATAACTTAGTTTGA
CTTAGATTGTAAAGAATTCAAGAGTGAAGTTTAACTTGCTACTATTTTAAAAGCATGTGA
CCTTATAGATCTGTAAGATGTGAGAGGTGTTGAATAATCTTTAATATTACACATAAACCA
CACTAAAATGCCTTTCAATAAGTAAAAGAAACCATTTTAAATACAGGGAATTATAATTAG
ATTGGCATAGTTAAGGCCAAAACTATAGACATTGCTACCTTATTTATCTTCAACCCTTGC
CTTTAAGAGGCAAATGAACATGAACACAAAACACAGGTGAATCTTGCTTGGTTCTAAGAC
AGTGAAGCANTTTCCCCAGTATTTAAATATATTCACATAACCAGTTATATAAATCTAANA
TATAAACCAATCTCCAGTAAGTTTTAAGATGCACTCACCATCTTTGTGAANAAGTGACAT
TACTANCGAAGTCTAATCATATCTTTAAAGGGGNTAANCAGTGATACCATTTACTGATTT
GGAGTTTACTATAAANATCANAAACTGGACATATTATTTAACCCCAGCCAGTTCTTAGTT
TAATCAGGACTGCCCCACAAATATCTGNCAGCATTCATGATCTGAATTCTGTGTTTGAAG
ATCATTAAAGGATGCTACCACTANAAGTCTGAACCATTTCTGTTTGTATAAAATAGGCNT
GCCCATATACTCATTANAAGCTTTTGGAAAAGCTATTAGNCTGCCCTTCTTCTTTCTTTA
TGCCACAGATACATTTTGTCCAGGGAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_018947
ORF Size 318 bp
Insert Size 1330
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_018947.4, NP_061820
RefSeq Size 5518
Locus ID 54205
Cytogenetics 7p15.3
Domains cytochrome_c
Protein Families Druggable Genome
Protein Pathways p53 signaling pathway, Apoptosis, Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis (ALS), Huntington's disease, Pathways in cancer, Colorectal cancer, Small cell lung cancer, Viral myocarditis
Gene Summary This gene encodes a small heme protein that functions as a central component of the electron transport chain in mitochondria. The encoded protein associates with the inner membrane of the mitochondrion where it accepts electrons from cytochrome b and transfers them to the cytochrome oxidase complex. This protein is also involved in initiation of apoptosis. Mutations in this gene are associated with autosomal dominant nonsyndromic thrombocytopenia. Numerous processed pseudogenes of this gene are found throughout the human genome.[provided by RefSeq, Jul 2010].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.