Pellino 1 (PELI1) (NM_020651) Human Untagged Clone

CAT#: SC113069

PELI1 (untagged)-Human pellino homolog 1 (Drosophila) (PELI1)


  "NM_020651" in other vectors (6)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PELI1 mouse monoclonal antibody, clone OTI13F8
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Pellino 1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Pellino 1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_020651, the custom clone sequence may differ by one or more nucleotides


ATGTTTTCTCCTGATCAAGAAAATCATCCATCTAAAGCACCAGTAAAATATGGTGAACTCATTGTCTTAG
GGTATAATGGGTCTCTCCCAAATGGCGATAGAGGAAGGAGGAAAAGTAGGTTTGCTTTGTTTAAAAGACC
TAAGGCAAATGGGGTGAAGCCCAGCACTGTGCATATTGCTTGTACTCCTCAGGCTGCAAAGGCAATAAGC
AACAAAGACCAGCATAGCATATCATATACTTTATCTCGGGCCCAGACTGTGGTGGTTGAATATACTCATG
ACAGCAACACCGATATGTTTCAGATTGGCCGGTCGACTGAAAGCCCCATTGATTTTGTAGTAACTGACAC
GGTTCCTGGAAGTCAAAGTAATTCTGATACACAGTCAGTACAAAGCACTATATCAAGATTTGCCTGCAGA
ATCATATGTGAACGGAATCCTCCCTTTACAGCACGGATTTATGCTGCAGGATTTGACTCATCAAAAAACA
TCTTTCTTGGGGAGAAGGCTGCCAAATGGAAGACATCAGATGGACAGATGGATGGCTTGACCACTAATGG
TGTTCTTGTGATGCATCCACGCAATGGGTTCACAGAAGACTCCAAGCCTGGAATATGGAGAGAAATATCG
GTGTGTGGAAATGTATTTAGCCTACGTGAAACCAGATCGGCTCAGCAGAGAGGAAAAATGGTGGAAATTG
AAACCAATCAGTTACAAGATGGCTCGTTAATTGACCTCTGTGGTGCAACATTGTTATGGCGTACTGCAGA
AGGCCTTTCCCACACTCCTACCGTGAAGCATTTAGAAGCTTTAAGACAGGAAATCAATGCAGCACGACCT
CAGTGCCCTGTAGGGTTCAACACACTAGCATTTCCTAGTATGAAGAGGAAAGACGTTGTAGATGAAAAAC
AACCATGGGTATATCTAAACTGCGGCCATGTACATGGCTATCATAACTGGGGAAACAAAGAAGAACGTGA
TGGAAAAGATCGTGAATGTCCTATGTGTAGGTCTGTTGGTCCCTATGTTCCTCTGTGGCTTGGATGTGAA
GCTGGATTTTATGTGGACGCCGGCCCTCCAACCCATGCGTTTAGCCCGTGTGGGCATGTGTGTTCAGAAA
AGACAACTGCCTATTGGTCCCAGATCCCACTTCCTCATGGTACTCATACTTTTCATGCAGCCTGTCCCTT
TTGTGCACATCAGTTGGCTGGTGAACAAGGCTACATCAGACTTATTTTTCAAGGACCTCTAGACTAA


Restriction Sites Please inquire     
ACCN NM_020651
Insert Size 3590 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020651.2, NP_065702.2
RefSeq Size 7136 bp
RefSeq ORF 1257 bp
Locus ID 57162
UniProt ID Q96FA3
Cytogenetics 2p14
Domains Pellino
Gene Summary E3 ubiquitin ligase catalyzing the covalent attachment of ubiquitin moieties onto substrate proteins. Involved in the TLR and IL-1 signaling pathways via interaction with the complex containing IRAK kinases and TRAF6. Mediates 'Lys-63'-linked polyubiquitination of IRAK1 allowing subsequent NF-kappa-B activation (PubMed:12496252, PubMed:17675297). Mediates 'Lys-48'-linked polyubiquitination of RIPK3 leading to its subsequent proteasome-dependent degradation; preferentially recognizes and mediates the degradation of the 'Thr-182' phosphorylated form of RIPK3 (PubMed:29883609). Negatively regulates necroptosis by reducing RIPK3 expression (PubMed:29883609). Mediates 'Lys-63'-linked ubiquitination of RIPK1 (PubMed:29883609).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.