TMEM35(TMEM35) (NM_021637) Human Untagged Clone

CAT#: SC112910

TMEM35 (untagged)-Human transmembrane protein 35 (TMEM35)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TMEM35(TMEM35) (NM_021637) Human Untagged Clone
Symbol TMEM35
Synonyms FLJ14084
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC112910 sequence for NM_021637 edited (data generated by NextGen Sequencing)
ATGGCATCCCCCAGAACCGTAACTATTGTGGCCCTCTCAGTGGCCCTGGGACTCTTCTTT
GTTTTCATGGGGACTATCAAGCTGACCCCCAGGCTCAGCAAGGATGCCTACAGTGAGATG
AAACGTGCTTACAAGAGCTATGTTCGAGCCCTCCCTCTGCTGAAGAAAATGGGGATCAAT
TCCATTCTCCTCCGAAAAAGCATTGGTGCCCTTGAAGTGGCCTGTGGCATCGTCATGACC
CTTGTGCCTGGGCGTCCCAAAGATGTGGCCAACTTCTTCCTACTGTTGCTGGTGTTGGCT
GTGCTCTTCTTCCACCAGCTGGTCGGTGATCCTCTCAAACGCTACGCCCATGCTCTGGTG
TTTGGAATCCTGCTCACTTGCCGCCTGCTGATTGCTCGCAAGCCCGAAGACCGGTCTTCT
GAGAAGAAGCCTTTGCCAGGGAATGCTGAGGAGCAACCCTCCTTATATGAGAAGGCCCCT
CAGGGCAAAGTGAAGGTGTCATAG

Clone variation with respect to NM_021637.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_021637 unedited
GTAAAGGACGTACCGTTGTATAACGCCTCCTAATAGGGCGGCCCGCGACTCTTCGGCAAC
GAGTCCTCGTGCCGAATTCGGCACGAGGCCTTTGTCATTCTAGCTGCCTGCTGCCTCCGC
AGCGTCCCCCCAGCTCTCCCTGTGCTAACTGCCTGCACCTTGGACAGAGCGGGTGCGCAA
ATCAGAAGGATTAGTTGGGACCTGCCTTGGCGACCCCATGGCATCCCCCAGAACCGTAAC
TATTGTGGCCCTCTCAGTGGCCCTGGGACTCTTCTTTGTTTTCATGGGGACTATCAAGCT
GACCCCCAGGCTCAGCAAGGATGCCTACAGTGAGATGAAACGTGCTTACAAGAGCTATGT
TCGAGCCCTCCCTCTGCTGAAGAAAATGGGGATCAATTCCATTCTCCTCCGAAAAAGCAT
TGGTGCCCTTGAAGTGGCCTGTGGCATCGTCATGACCCTTGTGCCTGGGCGTCCCAAAGA
TGTGGCCAACTTCTTCCTACTGTTGCTGGTGTTGGCTGTGCTCTTCTTCCACCAGCTGGT
CGGTGATCCTCTCAAACGCTACGCCCATGCTCTGGTGTTTGGAATCCTGCTCACTTGCCG
CCTGCTGATTGCTCGCAAGCCCGAAGACCGGTCTTCTGAGAAGAAGCCTTTGCCAGGGAA
TGCTGAGGAGCAACCCTCCTTATATGAGAAGGCCCCTCAGGGCAAAGTGAAGGTGTCATA
GAAAAGTGGAAGTGCAAAGAGTGGACCTTCCAGGCAGTTGCGTCCATGACACCAGGAAGA
TGTCAGTGTGTGTTTTTCATTTGATTTATTTATCTTGGGGAAAGTGAAAAATGTAATCTG
CAAGTTAATGACCCTATTGGCTTGTGTACATCTATATGCTAAAATGACTTCCCCACATTG
ACATTTGTGCGCCACCTTTTATT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_021637 unedited
TATGGACGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCA
AATTTCAAAAAGTTTTATTTTGAAAGAATGAGAGAAATAAAACAGAGAGGTTTCAATTAC
CAAAAACAATTACACTGAAAAAAACACAATAATAAGTACTTTTCCCACACAACCCCCCCC
ATTTCCCCATCCCTGGCACAATAATATTAAAACCACCAAAGCACACCTAACAAGGAAAAA
CAACAGTACGTAATGAAAAAAGCAAATGTCCATACTGCTCAGTCCAACTAACCCTTATGA
AATGTCCTTCCCCCAGCTAAACCCTACCCACTGGAATGATAAAAAAATGTAAAGACAACC
CTAGGGGAAACTTGGAACTCTGCTTATACTAGCAAAGCTCAGTGAAAAATCAGTAAAAGT
AGTGAATCTGTTTGGCAGTGAAACACTGGATATAGCTTCTTTTTCAAATTTTGGATGATT
GCAAAAAACAGGTAAAGTTTGAGGCTCACAGACTTCTAACAGGACTGATCCCTGTTCCCT
CAACCGTAACAGTGGAGCAGCTGCCAAATCCTGGTTGGCTGCTGAAAATAGTGGAAGTGA
GGCAACTTTGGGCTTAAGACAATCTGAAAAAGATGTCTGGAAACAAGTTTACTGCTTCAG
TTTCAAACTGTGAGTAAAGGGTTTTAATAGGTGGGGCTTGGACAAAGGCAGGTTGAAACT
TCCATATTATCACTTGAAGAATTAAACTATCAATTTGACTGCATGCATCCCCTTGTTTTA
AATAAATTCAATATGGGACTATTTAAAAATGTAAACNAACTGTTGGNACTAGAGCCTAAT
TAAATTCATATANTAACTCANTGTCCGAAAATGAATGTTTTTTTTTTTTCTCCTAAGTAA
TAAAGTTTAGNTTGTAGTATCTGGTGGAAAGATT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_021637
ORF Size 504 bp
Insert Size 2470
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021637.1, NP_067650
RefSeq Size 2039
Locus ID 59353
Cytogenetics Xq22.1
Protein Families Transmembrane
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations