TEF1(TEAD1) (NM_021961) Human Untagged Clone

CAT#: SC112830

TEAD1 (untagged)-ORIGENE UNIQUE VARIANT 1 of Human TEA domain family member 1 (SV40 transcriptional enhancer factor) (TEAD1)

USD 680.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TEF1(TEAD1) (NM_021961) Human Untagged Clone
Symbol TEAD1
Synonyms AA; NTEF-1; REF1; TCF-13; TCF13; TEAD-1; TEF-1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_021961, the custom clone sequence may differ by one or more nucleotides


ATTGAGCCCAGCAGCTGGAGCGGCAGTGAGAGCCCTGCCGAAAACATGGAAAGGATGAGTGACTCTGCAG
ATAAGCCAATTGACAATGATGCAGAAGGGGTCTGGAGCCCCGACATCGAGCAAAGCTTTCAGGAGGCCCT
GGCTATCTATCCACCATGTGGGAGGAGGAAAATCATCTTATCAGACGAAGGCAAAATGTATGGTAGGAAT
GAATTGATAGCCAGATACATCAAACTCAGGACAGGCAAGACGAGGACCAGAAAACAGGTGTCTAGTCACA
TTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGCTAAAGGATCAGACTGCAAAGGATAA
GGCCCTGCAGCACATGGCGGCCATGTCCTCAGCCCAGATCGTCTCGGCCACTGCCATTCATAACAAGCTG
GGGCTGCCTGGGATTCCACGCCCGACCTTCCCAGGGGCGCCGGGGTTCTGGCCGGGAATGATTCAAACAG
GGCAGCCAGGATCCTCACAAGACGTCAAGCCTTTTGTGCAGCAGGCCTACCCCATCCAGCCAGCGGTCAC
AGCCCCCATTCCAGGGTTTGAGCCTGCATCGGCCCCAGCTCCCTCAGTCCCTGCCTGGCAAGGTCGCTCC
ATTGGCACAACCAAGCTTCGCCTGGTGGAATTTTCAGCTTTTCTCGAGCAGCAGCGAGACCCAGACTCGT
ACAACAAACACCTCTTCGTGCACATTGGGCATGCCAACCATTCTTACAGTGACCCATTGCTTGAATCAGT
GGACATTCGTCAGATTTATGACAAATTTCCTGAAAAGAAAGGTGGCTTAAAGGAACTGTTTGGAAAGGGC
CCTCAAAATGCCTTCTTCCTCGTAAAATTCTGGGCTGATTTAAACTGCAATATTCAAGATGATGCTGGGG
CTTTTTATGGTGTAACCAGTCAGTACGAGAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTTTG
CTCCTTTGGGAAGCAAGTAGTAGAAAAAGTAGAGACGGAGTATGCAAGGTTTGAGAATGGCCGATTTGTA
TACCGAATAAACCGCTCCCCAATGTGTGAATATATGATCAACTTCATCCACAAGCTCAAACACTTACCAG
AGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTGGTAACAAACAGGGATACACA
AGAAACTCTACTCTGCATGGCCTGTGTGTTTGAAGTTTCAAATAGTGAACACGGAGCACAACATCATATT
TACAGGCTTGTAAAGGACTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_021961 unedited
TTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGCCGCGTCCAGGC
ACAGGCCATGCAGTGACGCCCCCCCACCCCTCCACCTTTGCCCGGAGCGCGGGCAGCAGC
CCAGCGCGCCAGCCGGCCCCGGGGCAGGAGCGGTGCTAGGCAGGGGTGGGGTGGCCGGGC
CCAGGGACCGGGAGCCGGGGAGGGAGCCGGGCACCGAGCAGAGGGCGGGGGAAGCGGCGC
CGAAGTTTGCCTCGGACTCGCCGGGCGCTGCGGTGGCTCCCTGGGCCGAGGACTGTTGCT
GCCGCTGCCGCCGCCGCTTCATTGCACATTCAAGTGGAAAATTTTCAGGAGTCAGCAGAA
ACATTGTGTCCAAAAAAGACTGAGTCGCAGTTACCACCAAACCCAGGAGGAGACTCTCCC
TGGAAAACTTCCCTTCCCTTTCGGTTTATTTTCTTGAAAAGGCTCCAGGCTTCGGCTTGG
AAAATCCCACCGCCAAAATTGAGCCCAGCAGCTGGAGCGGCAGTGAGAGCCCTGCCGAAA
ACATGGAAAGGATGAGTGACTCTGCAGATAAGCCAATTGACAATGATGCAGAAGGGGTCT
GGAGCCCCGACATCGAGCAAAGCTTTCAGGAGGCCCTGGCTATCTATCCACCATGTGGGA
GGAGGAAAATCATCTTATCAGACGAAGGGCAAATGTATGGTAGGAATGAATTGATAGCCA
GATACATCAAACTCAGGACAGGGCAGACGAGGACCAGANAACAGGTAAAATAAACCACCT
GGNAAATGTGCATGTCAGCGAATGGCCCANAAGGCATTNTGGCTGCAGGGGCTGGCTATG
CTTTTGCTCCTANGAGCCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_021961 unedited
TATGCACCGGCGGCCGCAATCTAGAGCCGAGTTTTTTTTTTTTTTTTTTAAAGGCCACTG
CTCAGATTTCTCTTTTAATAAGAGCGCCATTCACTTAAAAAACAGTAGTAAGCAATGTGG
AAGAAATCTGGCTGAAAATACTCTGAGGGAAGAGACATGCATGAAAAAGACGTATTTTTT
ATAAGCCTTCTTAAAAATACATCAAAAGCATGAGTTAAAATAATTTCTAAATTTTTTAAA
AAGGCCATTTCATGACCACTTTGGAAATGATTCTTTCTAAATAATTTCTACTCAATTTTG
CATCTCTGGACTTTCCTTTTTTTAAGCTCTCCTAGCCCATGGCTGTTTGCCGGACATCCG
ACGGTTAAAAACCAAAAAATCATGTTTCTGTGCTGAAAAGCTACCAAGACCACCTCTCTG
CTGCACCCGTATTGCTACCCGGAACACACACCTACACACGCCCACACCCACCCCACCACA
CTCTCCCTCTCCAATTCCCCCCCCTCATGCCCCGCCCTCCTCCTCCCCCCCCCCCTACCC
CCCCCACCCGCCCCCCTTTCTCTCCCCTTCCCTTCCCCTCCCCCCCCCCTTCTCTCCCCT
CCCCTCCCTTCTTCCCTCTCTCTTTCGTCTTTTTTCCTTCACCCCCTTCCCACCCCCCCT
CTCTCCCCATCCCCCCCCTCCCTTTTCCCCCCCCCCAACCCCCCCCCCCCTCCACCTCTC
CCCCCATTCCCTTTCCCCCCCCTCCCCCGACCCTATGCCCGCCCCATCTCCCCTCTTTTT
CCCCTCCTTTACCTTTCCCCCCTTTTTATTCCCCCCCCTTTCCCCGCTTATTACGCAACC
CCCCCNNNCCCCCCCCCCCCCCCCCCCNCCCCCNNCCCCACCCCCNCCCCCNCCCCCNCC
NCCCTCCCCCNCCCCNNCCCCCCCCCCCCCCNNCCNNNNNNNCCNNNNCCCCCCCCCNNN
CCGCCCCCCCCTACTCGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_021961
ORF Size 1236 bp
Insert Size 3890
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021961.3, NP_068780
RefSeq Size 8850
Locus ID 7003
Cytogenetics 11p15.3
Domains TEA
Protein Families Transcription Factors
Gene Summary This gene encodes a ubiquitous transcriptional enhancer factor that is a member of the TEA/ATTS domain family. This protein directs the transactivation of a wide variety of genes and, in placental cells, also acts as a transcriptional repressor. Mutations in this gene cause Sveinsson's chorioretinal atrophy. Additional transcript variants have been described but their full-length natures have not been experimentally verified. [provided by RefSeq, May 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations