Caspase 1(CASP1) (NM_033295) Human Untagged Clone

CAT#: SC112763

CASP1 (untagged)-Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant epsilon

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Caspase 1(CASP1) (NM_033295) Human Untagged Clone
Symbol CASP1
Synonyms ICE; IL1BC; P45
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_033295, the custom clone sequence may differ by one or more nucleotides


ATGGCCGACAAGGTCCTGAAGGAGAAGAGAAAGCTGTTTATCCGTTCCATGGGTGAAGATAATGTTTCTT
GGAGACATCCCACAATGGGCTCTGTTTTTATTGGAAGACTCATTGAACATATGCAAGAATATGCCTGTTC
CTGTGATGTGGAGGAAATTTTCCGCAAGGTTCGATTTTCATTTGAGCAGCCAGATGGTAGAGCGCAGATG
CCCACCACTGAAAGAGTGACTTTGACAAGATGTTTCTACCTCTTCCCAGGACATTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_033295 unedited
GATTATGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGCAGTAGGAGTTT
CTGGAAACCTATCTTTACCAACTACAGAAGAGTTTGAGGATGATGCTATTAAGAAAGCCC
ACATAGAGAAGGATTTTATCGCTTTCTGCTCTTCCACACCAGATAATGTTTCTTGGAGAC
ATCCCACAATGGGCTCTGTTTTTATTGGAAGACTCATTGAACATATGCAAGAATATGCCT
GTTCCTGTGATGTGGAGGAAATTTTCCGCAAGGTTCGATTTTCATTTGAGCAGCCAGATG
GTAGAGCGCAGATGCCCACCACTGAAAGAGTGACTTTGACAAGATGTTTCTACCTCTTCC
CAGGACATTAAAATAAGGAAACTGTATGAATGTCTGTGGGCAGGTACATGTGTATGGTCG
GGAGTGTGGGAAGGTTGAGGAAAGGGTACTGAAAGTCCATTTGAGTCAAGAACTCTAGGT
TTACAGGCTGAGAATCCTTAATCCAAAAATTTGAATTTTGAAATGCTCTAAAATCCAACA
CTGTGTGAGCGCCCACATGATATTCAAAGGAAATGTTTATTGAAACATTTCAAATTATAG
GTTTTTGGATTAGGGATGCTAAACCAGTAAGTATACAGCTGAATTCCAATATACAAAAAT
ATCTGAAATTTGAAATACTTCTGGTAGCATGCATTNTGGATAAGGGATAATCAAGCCATA
TACANGAAATACTGAAGTAATGTCTTTCTTCTGGTCAGTGCAGAGCACGTTGCTCTTCTC
CCAAGTTTTTCATTTAGACCCCTTTTGAGATCATCTGATATTGGCTAGAAGTGCCGTAGA
CTACAACCCTCACTTTTGATGTTTCTCTCCTTCCCTCAGCAGGNTATATTAAACATAGCA
TGTGGNNCTTCCTTTTAAAATGTGTATGNTCCCCATGGTGGNNNATACTTATACTNGCAT
GTCTTTACAAAATCCTTTNCTTGTTTA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_033295
ORF Size 267 bp
Insert Size 1650
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_033295.1, NP_150637
RefSeq Size 443
Locus ID 834
Cytogenetics 11q22.3
Protein Families Protease, Druggable Genome
Protein Pathways NOD-like receptor signaling pathway, Cytosolic DNA-sensing pathway, Amyotrophic lateral sclerosis (ALS)
Gene Summary This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (epsilon) has multiple differences in the coding region but the translation remains in frame, compared to variant alpha. Variant epsilon encodes a protein lacking an internal segment, compared to isoform alpha. Isoform epsilon lacks apoptosis-inducing activity.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.