Gasdermin D(GSDMD) (NM_024736) Human Untagged Clone

CAT#: SC112028

GSDMD (untagged)-Human gasdermin D (GSDMD), transcript variant 1

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gasdermin D(GSDMD) (NM_024736) Human Untagged Clone
Symbol GSDMD
Synonyms DF5L; DFNA5L; FKSG10; GSDMDC1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC112028 sequence for NM_024736 edited (data generated by NextGen Sequencing)
ATGGGGTCGGCCTTTGAGCGGGTAGTCCGGAGAGTGGTCCAGGAGCTGGACCATGGTGGG
GAGTTCATCCCTGTGACCAGCCTGCAGAGCTCCACTGGCTTCCAGCCCTACTGCCTGGTG
GTTAGGAAGCCCTCAAGCTCATGGTTCTGGAAACCCCGTTATAAGTGTGTCAACCTGTCT
ATCAAGGACATCCTGGAGCCGGATGCCGCGGAACCAGACGTGCAGCGTGGCAGGAGCTTC
CACTTCTACGATGCCATGGATGGGCAGATACAGGGCAGCGTGGAGCTGGCAGCCCCAGGA
CAGGCAAAGATCGCAGGCGGGGCCGCGGTGTCTGACAGCTCCAGCACCTCAATGAATGTG
TACTCGCTGAGTGTGGACCCTAACACCTGGCAGACTCTGCTCCATGAGAGGCACCTGCGG
CAGCCAGAACACAAAGTCCTGCAGCAGCTGCGCAGCCGCGGGGACAACGTGTACGTGGTG
ACTGAGGTGCTGCAGACACAGAAGGAGGTGGAAGTCACGCGCACCCACAAGCGGGAGGGC
TCGGGCCGGTTTTCCCTGCCCGGAGCCACGTGCTTGCAGGGTGAGGGCCAGGGCCATCTG
AGCCAGAAGAAGACGGTCACCATCCCCTCAGGCAGCACCCTCGCATTCCGGGTGGCCCAG
CTGGTTATTGACTCTGACTTGGACGTCCTTCTCTTCCCGGATAAGAAGCAGAGGACCTTC
CAGCCACCCGCGACAGGCCACAAGCGTTCCACGAGCGAAGGCGCCTGGCCACAGCTGCCC
TCTGGCCTCTCCATGATGAGGTGCCTCCACAACTTCCTGACAGATGGGGTCCCTGCGGAG
GGGGCGTTCACTGAAGACTTCCAGGGCCTACGGGCAGAGGTGGAGACCATCTCCAAGGAA
CTGGAGCTTTTGGACAGAGAGCTGTGCCAGCTGCTGCTGGAGGGCCTGGAGGGGGTGCTG
CGGGACCAGCTGGCCCTGCGAGCCTTGGAGGAGGCGCTGGAGCAGGGCCAGAGCCTTGGG
CCGGTGGAGCCCCTGGACGGTCCAGCAGGTGCTGTCCTGGAGTGCCTGGTGTTGTCCTCC
GGAATGCTGGTGCCGGAACTCGCTATCCCTGTTGTCTACCTGCTGGGGGCACTGACCATG
CTGAGTGAAACGCAGCACAAGCTGCTGGCGGAGGCGCTGGAGTCGCAGACCCTGTTGGGG
CCGCTCGAGCTGGTGGGCAGCCTCTTGGAGCAGAGTGCCCCGTGGCAGGAGCGCAGCACC
ATGTCCCTGCCCCCCGGGCTCCTGGGGAACAGCTGGGGCGAAGGAGCACCGGCCTGGGTC
TTGCTGGACGAGTGTGGCCTAGAGCTGGGGGAGGACACTCCCCACGTGTGCTGGGAGCCG
CAGGCCCAGGGCCGCATGTGTGCACTCTACGCCTCCCTGGCACTGCTATCAGGACTGAGC
CAGGAGCCCCACTAG

Clone variation with respect to NM_024736.6
5' Read Nucleotide Sequence
>OriGene 5' read for NM_024736 unedited
TTCCGATTTTGTAATACGACTTCACTATAGGGCGGCCGCGAATTCGCACGAGGCCAGACG
CGCCACCCTCGGGGCGCCGACGGTCACGGAGCATGGGGTCGGCCTTTGAGCGGGTAGTCC
GGAGAGTGGTCCAGGAGCTGGACCATGGTGGGGAGTTCATCCCTGTGACCAGCCTGCAGA
GCTCCACTGGCTTCCAGCCCTACTGCCTGGTGGTTAGGAAGCCCTCAAGCTCATGGTTCT
GGAAACCCCGTTATAAGTGTGTCAACCTGTCTATCAAGGACATCCTGGAGCCGGATGCCG
CGGAACCAGACGTGCAGCGTGGCAGGAGCTTCCACTTCTACGATGCCATGGATGGGCAGA
TACAGGGCAGCGTGGAGCTGGCAGCCCCAGGACAGGCAAAGATCGCAGGCGGGGCCGCGG
TGTCTGACAGCTCCAGCACCTCAATGAATGTGTACTCGCTGAGTGTGGACCCTAACACCT
GGCAGACTCTGCTCCATGAGAGGCACCTGCGGCAGCCAGAACACAAAGTCCTGCAGCAGC
TGCGCAGCCGCGGGGACAACGTGTACGTGGTGACTGAGGTGCTGCAGACACAGAAGGAGG
TGGAAGTCACGCGCACCCACAAGCGGGAGGGCTCGGGCCGGTTTTCCCTGCCCGGAGCCA
CGTGCTTGCAGGGTGAGGGCCAGGGCCATCTGAGCCAGAAGAAGACGGTCACCATCCCCT
CAGGCAGCACCCTCGCATTCCGGGTGGCCCAGCTGGTTATTGACTCTGACTTGNACGTCC
TTCTCTTCCCGGATAAGAGCAGAGGACCTTCCAGCCACCCGCGACAGGCCACAGCGTTCA
CGAGCGAAGCGCCTGGCCCAGCTGCCTCTGGCTCTCATGATGAGGTGCCTCACACTTCTG
AAGAGGGGTCCTGCGAGGGGCGTTCCTGAGACTTNCAGGCTACGGCAGAGTGGAACATCT
CCA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_024736 unedited
CTATGGACCGCGCCGCAATTTANGATCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTCCTTCGTATGCCACCTTTATTGGGTTTCCCCAACTCCTGGGCCCCATGG
TAAACTGGCCACATGGCTACTGGGCTCCTGGCCTTCCTAGGGCTAGCAGCTGGGGGGCAA
ACACTCTGCCCTGCTGGAAAGCTGCCAGGCCATGCCCGGGCACAGGCTAGTGGGGCTCCT
GGCTCAGTCCTGATAGCAGTGCCAGGGAGGCGTAAAGTGCACACATGCGGCCCTGGGCCT
GCGGCTCCCAGCACACGTGGGGAGTGTCCTCCCCCAGCTTTAGGCCACACTCGTCCAGCA
AGACCCAGGCCGGTGCTCCTTCGCCCCAGCTGTTCCCCAGGAGCCCGGGGGGCAGGGACA
TGGTGCTGCGCTCCTGCCACGGGGCACTCTGCTCCAAGAGGCTGCCCACCAGCTCGAGCG
GCCCCAACAGGGTCTGCGACTCCAGCGCCTCCGCCAGCAGCTTGTGCTGCGTTTCACTCA
GCATGGTCAGTGCCCCCAGCAGGTAGACAACAGGGATAGCGAGTTCCGGCACCAGCATTC
CGGAGGACAACACCAGGCACTCCAGGACAGCACCTGCTGGACCGTCCAGGGGCTCCACCG
GCCCAAGGCTCTGGCCCTGGCTCAGCGCCTCCTCCAAGCTCGCAGGGCCAGCTGGTCCCG
CAGCACCCCCTTCAGGCCCCTCAGCAGCAGCTGGCAAAGCTTCTGTCCAAAAGCTCCAGT
TCCTTTGGAGATGGTCTCCACCTCTGCCCGTAGGCCCTGNAAGTCTCAATGAACGCCCCC
TCCGCAGGGACCCATCTGTCAGNAAGTTGTGGAAGCACCTTCTCATGGAAAGCCCAAGGG
CANCTGTGGCCAGGCCCCTCCCTCGTGGAACCCTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_024736
ORF Size 1455 bp
Insert Size 1750
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_024736.3, NP_079012
RefSeq Size 1823
Locus ID 79792
Cytogenetics 8q24.3
Domains DFNA5
Gene Summary Gasdermin D is a member of the gasdermin family. Members of this family appear to play a role in regulation of epithelial proliferation. Gasdermin D has been suggested to act as a tumor suppressor. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009].
Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.