LACTB (NM_032857) Human Untagged Clone

CAT#: SC111862

LACTB (untagged)-Human lactamase, beta (LACTB), nuclear gene encoding mitochondrial protein, transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name LACTB (NM_032857) Human Untagged Clone
Symbol LACTB
Synonyms G24; MRPL56
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_032857, the custom clone sequence may differ by one or more nucleotides


ATGTACCGGCTCATGTCAGCAGTGACTGCCCGGGCTGCCGCCCCCGGGGGCTTGGCCTCAAGCTGCGGAC
GACGCGGGGTCCATCAGCGCGCCGGGCTGCCGCCTCTCGGCCACGGCTGGGTCGGGGGCCTCGGGCTGGG
GCTGGGGCTGGCGCTCGGGGTGAAGCTGGCAGGTGGGCTGAGGGGCGCGGCCCCGGCGCAGTCCCCCGCG
GCCCCCGACCCTGAGGCGTCGCCTCTGGCCGAGCCGCCACAGGAGCAGTCCCTCGCCCCGTGGTCTCCGC
AGACCCCGGCGCCGCCCTGCTCCAGGTGCTTCGCCAGAGCCATCGAGAGCAGCCGCGACCTGCTGCACAG
GATCAAGGATGAGGTGGGCGCACCGGGCATAGTGGTTGGAGTTTCTGTAGATGGAAAAGAAGTCTGGTCA
GAAGGTTTAGGTTATGCTGATGTTGAGAACCGTGTACCATGTAAACCAGAGACAGTTATGCGAATTGCTA
GCATCAGCAAAAGTCTCACCATGGTTGCTCTTGCCAAATTGTGGGAAGCAGGGAAACTGGATCTTGATAT
TCCAGTACAACATTATGTTCCCGAATTCCCAGAAAAAGAATATGAAGGTGAAAAGGTTTCTGTCACAACA
AGATTACTGATTTCCCATTTAAGTGGAATTCGTCATTATGAAAAGGACATAAAAAAGGTGAAAGAAGAGA
AAGCTTATAAAGCCTTGAAGATGATGAAAGAGAATGTTGCATTTGAGCAAGAAAAAGAAGGCAAAAGTAA
TGAAAAGAATGATTTTACTAAATTTAAAACAGAGCAGGAGAATGAAGCCAAATGCCGGAATTCAAAACCT
GGCAAGAAAAAGAATGATTTTGAACAAGGCGAATTATATTTGAGAGAAAAGTTTGAAAATTCAATTGAAT
CCCTAAGATTATTTAAAAATGATCCTTTGTTCTTCAAACCTGGTAGTCAGTTTTTGTATTCAACTTTTGG
CTATACCCTACTGGCAGCCATAGTAGAGAGAGCTTCAGGATGTAAATATTTGGACTATATGCAGAAAATA
TTCCATGACTTGGATATGCTGACGACTGTGCAGGAAGAAAACGAGCCAGTGATTTACAATAGAGCAAGAT
TTTATGTTTACAATAAAAAGAAACGTCTTGTCAACACACCTTACGTGGATAACTCCTATAAATGGGCTGG
TGGTGGATTTCTGTCTACAGTGGGTGACCTTCTGAAATTTGGGAATGCAATGCTTTATGGTTACCAAGTT
GGGCTGTTTAAGAACTCAAATGAAAATCTTTTACCTGGATACCTCAAACCAGAAACAATGGTTATGATGT
GGACCCCAGTCCCTAACACAGAGATGTCTTGGGATAAAGAGGGTAAATATGCAATGGCGTGGGGTGTTGT
GGAAAGGAAACAAACGTATGGTTCGTGTAGAAAGCAACGGCATTATGCTTCACATACTGGAGGGGCAGTG
GGTGCCAGTAGTGTCCTGCTGGTCCTTCCTGAAGAACTGGATACAGAGACTATAAATAACAAGGTTCCCC
CAAGAGGAATCATTGTTTCTATCATATGTAACATGCAATCTGTTGGCCTCAATAGCACCGCTTTGAAGAT
TGCCCTTGAATTTGATAAAGACAGATCAGACTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_032857 unedited
GATATTTGTATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGAGACGCCATGT
ACCGGCTCCTGTCAGCAGTGACTGCCCGGGCTGCCGCCCCCGGGGGCTTGGCCTCAAGCT
GCGGACGACGCGGGGTCCATCAGCGCGCCGGGCTGCCGCCTCTCGGCACGGTGGGTTCGN
GGGCCTCGGGCTGGGGCTGGGGCTGGCGCTCGGGGTGAAGCTGGCAGGTGGGCTGAGGGG
CGCGGCCCCGGCGCAGTCCCCCGCGGCCCCCGACCCTGAGGCGTCGCCTCTGGCCGAGCC
GCCACAGGAGCAGTCCCTCGCCCCGTGGTCTCCGCAGACCCCGGCGCCGCCCTGCTCCAG
GTGCTTCGCCAGAGCCATCGAGAGCAGCCGCGACCTGCTGCACAGGATCAAGGATGAGGT
GGGCGCACCGGGCATAGTGGTTGGAGTTTCTGTAGATGGAAAAGAAGTCTGGTCAGAAGG
TTTAGGTTATGCTGATGTTGAGAACCGTGTACCATGTAAACCAAAGACAGTTATGCGAAT
TGCTAGCATCAGCAAAAGTCTCACCATGGTTGCTCTTGCCAAATTGTGGGAAGCAGGGAA
ACTGGATCTTGATATTTCAGTAAAACATTATGTTCCCGAATTCCCAAAAAAAGAATATGA
AGGTGAAAAGGTTTCTGTTAAAACAAGATTACTGATTTTTCATTTAAAGGGGAATCTTTC
ATTATGAAAAAGACATAATAAAGGTGAAAGAAGAAAAAACTTATTAAAGCTTTTGAAAAG
ATCAAAAATAAATGTTGCATTTTGTTCTATAAAAATAACGCCAAAATTATGGAAAAAAAG
GATTTTATTAAATTAAAACAGAGCACGGATAATGAAGCCAAAAGCCGGAATTAAAACTTT
GCAGAAAAAAAAAGATTTTTAACAAGGCAATTAATTTGAAAGAAAAATCGAAACATCATG
ATCCCCAAAAATATAAAAAAATCTTTTTTTTTCAACTCGATAAAAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_032857
ORF Size 1644 bp
Insert Size 2000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_032857.2, NP_116246
RefSeq Size 1956
Locus ID 114294
Cytogenetics 15q22.2
Domains beta-lactamase
Protein Families Protease
Gene Summary This gene encodes a mitochondrially-localized protein that has sequence similarity to prokaryotic beta-lactamases. Many of the residues responsible for beta-lactamase activity are not conserved in this protein, suggesting it may have a different enzymatic function. Increased expression of the related mouse gene was found to be associated with obesity. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (1) encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.