Prostaglandin E Synthase(PTGES) (NM_004878) Human Untagged Clone

CAT#: SC111734

PTGES (untagged)-Human prostaglandin E synthase (PTGES)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Prostaglandin E Synthase(PTGES) (NM_004878) Human Untagged Clone
Symbol PTGES
Synonyms MGST-IV; MGST1-L1; MGST1L1; MPGES; mPGES-1; PGES; PIG12; PP102; PP1294; TP53I12
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111734 sequence for NM_004878 edited (data generated by NextGen Sequencing)
ATGCCTGCCCACAGCCTGGTGATGAGCAGCCCGGCCCTCCCGGCCTTCCTGCTCTGCAGC
ACGCTGCTGGTCATCAAGATGTACGTGGTGGCCATCATCACGGGCCAAGTGAGGCTGCGG
AAGAAGGCCTTTGCCAACCCCGAGGATGCCCTGAGACACGGAGGCCCCCAGTATTGCAGG
AGCGACCCCGACGTGGAACGCTGCCTCAGGGCCCACCGGAACGACATGGAGACCATCTAC
CCCTTCCTTTTCCTGGGCTTCGTCTACTCCTTTCTGGGTCCTAACCCTTTTGTCGCCTGG
ATGCACTTCCTGGTCTTCCTCGTGGGCCGTGTGGCACACACCGTGGCCTACCTGGGGAAG
CTGCGGGCACCCATCCGCTCCGTGACCTACACCCTGGCCCAGCTCCCCTGCGCCTCCATG
GCTCTGCAGATCCTCTGGGAAGCGGCCCGCCACCTGTGA

Clone variation with respect to NM_004878.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004878 unedited
TATTTTGTAATACGACTCACTATAGGCGGCCCGCGAATTCGCACGAGGGTTGAGCTGCGC
TGGCCAGAGATGCCTGCCCACAGCCTGGTGATGAGCAGCCCGGCCCTCCCGGCCTTCCTG
CTCTGCAGCACGCTGCTGGTCATCAAGATGTACGTGGTGGCCATCATCACGGGCCAAGTG
AGGCTGCGGAAGAAGGCCTTTGCCAACCCCGAGGATGCCCTGAGACACGGAGGCCCCCAG
TATTGCAGGAGCGACCCCGACGTGGAACGCTGCCTCAGGGCCCACCGGAACGACATGGAG
ACCATCTACCCCTTCCTTTTCCTGGGCTTCGTCTACTCCTTTCTGGGTCCTAACCCTTTT
GCCGCCTGGATGCACTTCCTGGTCTTCCTCGTGGGCCGTGTGGCACACACCGTGGCCTAC
CTGGGGAAGCTGCGGGCACCCATCCGCTCCGTGACCTACACCCTGGCCCAGCTCCCCTGC
GCCTCCATGGCTCTGCAGATCCTCTGGGAAGCGGCCCGCCACCTGTGACCAGCAGCGGAT
GCCTCCTTGGCCACCAGACCATGGGCCAAGAGCCGCCGTGGCTATACCTGGGGACTTGAT
GTTCCTTCCAGATTGTGGTGGGCCCTGAGTCCTGGTTTCCTGGCAGCCTGCTGCGCGTGT
GGGTCTCTGGGCACAGTGGGCCTGTGTGTGTGCCCGTGTGTGTGTATGTGTGTGTGTATG
TTTCTTAGCCCCTTGGATTCCTGCACGAAGTGGCTGATGGGAACCATNNTCAGACAGATG
TGAAGATTGATAGAAAATCCTTCAGCTAAAGTACAGAGCATCAAAACATCACTTCCTCTC
CCTTCCCTACAGTGAAAGAGAGAGGNAGACTCTATNTAAGAATCCCAACCCTATGATCAT
CTGAATCCCGGGGCTAGATGCAGACTTTCAGACTGACCCCANAAATCTGCCCCACCATCT
AGAGGCAGCTGGCCTCTGNATTTTTT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004878 unedited
NNNNTTTTNNNNNNNNNNNNNNAAAAAAAAAAAAAAGAATTGTCACTTACCTTTNATGGA
CTAAAAACACACANCTNCAGGTNCACGGGTCTAGGNANAAACACACACACACACACACAC
ACACACACACACACACACACACACGGATTCCCCATCAAGGGGACATTTGCAGTTTCCAAA
CCTTGAAGATACTGAAGGGACCAGAAAGTTCCTTTGAGTGGCTGGTCACCCAAAGCTCCC
GGTCCTCCACCCACTGCCCTTTGGAGGGACTCAAACCTTGGGAGGAGAAGGCTGAGCTTC
CTGTGGGCCCCTCCCACCCACACCTGAGCCAGAGAGAAGACTGCAGCAAAGACATCCAAA
GCCAACGGCAAGGGAAGCGTCAGCGGGGGCAGAGGAGCCAGCCCTGTCCTTGGCTCACCC
AGCTTCCACCATACAGGAACCCAAGACCCCAGCCTTGCTTCCACAGAGAACTGGCAGGGG
TCCCCTGGCCTGGCCATCACAGGGACTCACATGGGAGCCTTTTAAAACTCCAGATGGTGG
CTGAGCACAGTGATTCATGCCTGTCATCCCAGCACTTTGGGAGGCCGAGGCCGGTGGATC
ACTTGAGGCCAGGAGTTCGAGACCCTCCTGGGCAACATGGTGAACCCGTCTCTACTAAAA
ATACAAAAATTAGCTGGGTATGGTGATACGCGCCTGTAATCCCAGCTACTCAGGAGGCTG
AGGCGGGAGAATCGTTTGAACCCGGGAGCGGAGGCTGCAGTGAGCCATATTGTACCACTT
CACTCCAGTTTGGGCAACAGAGCAAGACTCTGTTTTGAAAAAAAAAATACAGTGGCCAGG
CTTGCCTTTAGATGGCTGGGGCAAAATTTTTGGGGTCATCTAAAAGTCTGCATTTTTACC
CCGGGATTAAAAGACCATTAGTTTGGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004878
ORF Size 459 bp
Insert Size 1860
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004878.3, NP_004869
RefSeq Size 1805
Locus ID 9536
Cytogenetics 9q34.11
Domains MAPEG
Protein Families Transmembrane, Druggable Genome
Protein Pathways Arachidonic acid metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene is a glutathione-dependent prostaglandin E synthase. The expression of this gene has been shown to be induced by proinflammatory cytokine interleukin 1 beta (IL1B). Its expression can also be induced by tumor suppressor protein TP53, and may be involved in TP53 induced apoptosis. Knockout studies in mice suggest that this gene may contribute to the pathogenesis of collagen-induced arthritis and mediate acute pain during inflammatory responses. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations