PSMD4 (NM_002810) Human Untagged Clone

CAT#: SC111678

Reviews ()
Write a review

PSMD4 (untagged)-Human proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 (PSMD4)



Reconstitution Protocol

USD 457.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PSMD4
Synonyms AF; AF-1; ASF; MCB1; pUB-R5; Rpn10; S5A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC111678 sequence for NM_002810 edited (data generated by NextGen Sequencing)
ATGGTGTTGGAAAGCACTATGGTGTGTGTGGACAACAGTGAGTATATGCGGAATGGAGAC
TTCTTACCCACCAGGCTGCAGGCCCAGCAGGATGCTGTCAACATAGTTTGTCATTCAAAG
ACCCGCAGCAACCCTGAGAACAACGTGGGCCTTATCACACTGGCTAATGACTGTGAAGTG
CTGACCACACTCACCCCAGACACTGGCCGTATCCTGTCCAAGCTACATACTGTCCAACCC
AAGGGCAAGATCACCTTCTGCACGGGCATCCGCGTGGCCCATCTGGCTCTGAAGCACCGA
CAAGGCAAGAATCACAAGATGCGCATCATTGCCTTTGTGGGAAGCCCAGTGGAGGACAAT
GAGAAGGATCTGGTGAAACTGGCTAAACGCCTCAAGAAGGAGAAAGTAAATGTTGACATT
ATCAATTTTGGGGAAGAGGAGGTGAACACAGAAAAGCTGACAGCCTTTGTAAACACGTTG
AATGGCAAAGATGGAACCGGTTCTCATCTGGTGACAGTGCCTCCTGGGCCCAGTTTGGCT
GATGCTCTCATCAGTTCTCCGATTTTGGCTGGTGAAGGTGGTGCCATGCTGGGTCTTGGT
GCCAGTGACTTTGAATTTGGAGTAGATCCCAGTGCTGATCCTGAGCTGGCCTTGGCCCTT
CGTGTATCTATGGAAGAGCAGCGGCAGCGGCAGGAGGAGGAGGCCCGGCGGGCAGCTGCA
GCTTCTGCTGCTGAGGCCGGGATTGCTACGACTGGGACTGAAGACTCAGACGATGCCCTG
CTGAAGATGACCATCAGCCAGCAAGAGTTTGGCCGCACTGGGCTTCCTGACCTAAGCAGT
ATGACTGAGGAAGAGCAGATTGCTTATGCCATGCAGATGTCCCTGCAGGGAGCAGAGTTT
GGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGACACATCCGAGCCAGCC
AAGGAGGAGGATGATTACGACGTGATGCAGGACCCCGAGTTCCTTCAGAGTGTCCTAGAG
AACCTCCCAGGTGTGGATCCCAACAATGAAGCCATTCGAAATGCTATGGGCTCCCTGGCC
TCCCAGGCCACCAAGGACGGCAAGAAGGACAAGAAGGAGGAAGACAAGAAGTGA

Clone variation with respect to NM_002810.2
951 t=>c
>OriGene 5' read for NM_002810 unedited
NAACGGTTCCAANNCATATTTGGTNNAATNACCGNAACTNCACTTATNNAGGGNNCGGCN
NCGCGNAATTNCGGNCACGAAGGGNAGGNNAAGGTGGCAAGNAATGGTGTTGGNAAAGCA
CTATGGTGTGTGTGGACAACAGTGAGTATATGCGGAATGGAGACTTCTTACCCACCAGGC
TGCAGGCCCAGCAGGATGCTGTCAACATAGTTTGTCATTCAAAGACCCGCAGCAACCCTG
AGAACAACGTGGGCCTTATCACACTGGCTAATGACTGTGAAGTGCTGACCACACTCACCC
CAGACACTGGCCGTATCCTGTCCAAGCTACATACTGTCCAACCCAAGGGCAAGATCACCT
TCTGCACGGGCATCCGCGTGGCCCATCTGGCTCTGAAGCACCGACAAGGCAAGAATCACA
AGATGCGCATCATTGCCTTTGTGGGAAGCCCAGTGGAGGACAATGAGAAGGATCTGGTGA
AACTGGCTAAACGCCTCAAGAAGGAGAAAGTAAATGTTGACATTATCAATTTTGGGGAAG
AGGAGGTGAACACAGAAAAGCTGACAGCCTTTGTAAACACGTTGAATGGCAAAGATGGAA
CCGGTTCTCATCTGGTGACAGTGCCTCCTGGGCCCAGTTTGGCTGATGCTCTCATCAGTT
CTCCGATTTTGGCTGGTGAAGGTGGTGCCATGCTGGGTCTTGGTGCCAGTGACTNTGAAT
TTGGAGTAGATCCCAGTGCTGATCCTGAGCTGGCCTTGGCCCTTCGTGTATCTATGGAAA
AGCANCGCANNNCGCANNGAGAGGGAGGCCCCGCGGCCAGCTGCAGCTTCTGCTGCTNGA
GCCGGGATTGCTACGACTGGGACTGAAGACTCANACGATGCCCTGCTTGAGATGACCATC
AGCANCCAAGAATTGGNCCGCACTGGGCTTTCTGACCTAGC
>OriGene 3' read for NM_002810 unedited
GGACCTTGGAATGGCAACTTCCAGGNCCAGNAAAGCACTGGGGNAGGGTCACAGGGATGC
CACCCGGGATCTGTTCAGGAAAAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTT
TTTTTTTTTTTTTTTAAAAGTTGCCAAGCTTTATTTAGGCTGTAATGGTTACAGATAACA
CACATCTAACCCTATATATCCGTGCTTCCCATGCAGTCCCCTAAGCAGACTCAGCTACCC
TTTCCCTCCAGTCTCACTTCTTGTCTTCCTCCTTCTTGTCCTTCTTGCCGTCCTTGGTGG
CCTGGGAGGCCAGGGAGCCCATAGCATTTCGAATGGCTTCATTGTTGGGATCCACACCTG
GGAGGTTCTCTAGGACACTCTGAAGGAACTCGGGGTCCTGCATCACGTCGTAATCATCCT
CCTCCTTGGCTGGCTCGGATGTGTCCATAGCTGAGCTGGCATCAATGTCTGCTGATTCCG
CCTGGCCAAACTCTGCTCCCTGCAGGACATCTGCATGGCATAAGCAATCTGCTCTTCCTC
AGTCATACTGCTTAGGTCAGGAAGCCCAGTGCGGCCAAACATTTGCTGGCTGATGGTCAT
CTTCAGCAAGGGCATCGTCTGAGTCCTCCAATCCCAGTCCGTAGCAAATCCCGGCCTTAG
CAGCAAAAGCTGCACCTGCCCGCCGGGCCTCCTCCTCCCTGCGATTCCGGCTGCTTTTTC
ATAGAAACCCCGAAGGGCCCAGGCCCACTTAAGGTCAGCACTGGGATCCTTCTCCAATTG
AAGGTCCGGGGACACAAGACCCGTATGGGAACCTCTTAACCGCGCAAATGCGAAAACTTG
TTCAAGAATCGCCAAATTTGGCCCCACGGACACTGCACCAAAAGATAAACCGTTTCCTTT
CTTTC
Restriction Sites NotI-NotI     
ACCN NM_002810
Insert Size 1350 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002810.1, NP_002801.1
RefSeq Size 1313 bp
RefSeq ORF 1134 bp
Locus ID 5710
UniProt ID P55036
Cytogenetics 1q21.3
Domains VWA, UIM
Protein Pathways Proteasome
Gene Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. Pseudogenes have been identified on chromosomes 10 and 21. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
Other products for "PSMD4"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.