HNRPM(HNRNPM) (NM_005968) Human Untagged Clone

CAT#: SC111657

HNRNPM (untagged)-Human heterogeneous nuclear ribonucleoprotein M (HNRNPM), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HNRPM(HNRNPM) (NM_005968) Human Untagged Clone
Symbol HNRNPM
Synonyms CEAR; hnRNP M; HNRNPM4; HNRPM; HNRPM4; HTGR1; NAGR1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005968, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCAGGGGTCGAAGCGGCGGCGGAGGTGGCGGCGACGGAGATCAAAATGGAGGAAGAGAGCGGCG
CGCCCGGCGTGCCGAGCGGCAACGGGGCTCCGGGCCCTAAGGGTGAAGGAGAACGACCTGCTCAGAATGA
GAAGAGGAAGGAGAAAAACATAAAAAGAGGAGGCAATCGCTTTGAGCCATATGCCAATCCAACTAAAAGA
TACAGAGCCTTCATTACAAACATACCTTTTGATGTGAAATGGCAGTCACTTAAAGACCTGGTTAAAGAAA
AAGTTGGTGAGGTAACATACGTGGAGCTCTTAATGGACGCTGAAGGAAAGTCAAGGGGATGTGCTGTTGT
TGAATTCAAGATGGAAGAGAGCATGAAAAAAGCTGCGGAAGTCCTAAACAAGCATAGTCTGAGCGGAAGA
CCACTGAAAGTCAAAGAAGATCCTGATGGTGAACATGCCAGGAGAGCAATGCAAAAGGTGATGGCTACGA
CTGGTGGGATGGGTATGGGACCAGGTGGCCCAGGAATGATTACTATCCCACCCAGTATCCTAAATAATCC
CAACATCCCAAATGAGATTATCCATGCATTACAGGCTGGAAGACTTGGAAGCACAGTATTTGTAGCAAAT
CTGGATTATAAAGTTGGCTGGAAGAAACTGAAGGAAGTATTTAGTATGGCTGGTGTGGTGGTCCGAGCAG
ACATTCTTGAAGATAAAGATGGAAAAAGTCGTGGAATAGGCACTGTTACTTTTGAACAGTCCATTGAAGC
TGTGCAAGCTATATCTATGTTCAATGGCCAGCTGCTATTTGATAGACCAATGCACGTCAAGATGGATGAG
AGGGCCTTACCAAAAGGAGATTTCTTCCCTCCTGAGCGTCCACAACAACTTCCCCATGGCCTTGGTGGTA
TTGGCATGGGGTTAGGACCAGGAGGGCAACCCATTGATGCCAATCACCTGAATAAAGGCATCGGAATGGG
AAACATAGGTCCCGCAGGAATGGGAATGGAAGGCATAGGATTTGGAATAAATAAAATGGGAGGAATGGAG
GGGCCCTTTGGTGGTGGTATGGAAAACATGGGTCGATTTGGATCTGGGATGAACATGGGCAGGATAAATG
AAATCCTAAGTAATGCACTGAAGAGAGGAGAGATCATTGCAAAGCAGGGAGGAGGTGGAGGTGGAGGAAG
CGTCCCTGGGATCGAGAGGATGGGTCCTGGCATTGACCGCCTCGGGGGTGCCGGCATGGAGCGCATGGGC
GCGGGCCTGGGCCACGGCATGGATCGCGTGGGCTCCGAGATCGAGCGCATGGGCCTGGTCATGGACCGCA
TGGGCTCCGTGGAGCGCATGGGCTCCGGCATTGAGCGCATGGGCCCGCTGGGCCTCGACCACATGGCCTC
CAGCATTGAGCGCATGGGCCAGACCATGGAGCGCATTGGCTCTGGCGTGGAGCGCATGGGTGCCGGCATG
GGCTTCGGCCTTGAGCGCATGGCCGCTCCCATCGACCGTGTGGGCCAGACCATTGAGCGCATGGGCTCTG
GCGTGGAGCGCATGGGCCCTGCCATCGAGCGCATGGGCCTGAGCATGGAGCGCATGGTGCCCGCAGGTAT
GGGAGCTGGCCTGGAGCGCATGGGCCCCGTGATGGATCGCATGGCCACCGGCCTGGAGCGCATGGGCGCC
AACAATCTGGAGCGGATGGGCCTGGAGCGCATGGGCGCCAACAGCCTCGAGCGCATGGGCCTGGAGCGCA
TGGGTGCCAACAGCCTCGAGCGCATGGGCCCTGCCATGGGCCCGGCCCTGGGCGCTGGCATTGAGCGCAT
GGGCCTGGCCATGGGTGGCGGTGGCGGTGCCAGCTTTGACCGTGCCATCGAGATGGAGCGTGGCAACTTC
GGAGGAAGCTTCGCAGGTTCCTTTGGTGGAGCTGGAGGCCATGCTCCTGGGGTGGCCAGGAAGGCCTGCC
AGATATTTGTGAGAAATCTGCCATTCGATTTCACATGGAAGATGCTAAAGGACAAATTCAACGAGTGCGG
CCACGTGCTGTACGCCGACATCAAGATGGAGAATGGGAAGTCCAAGGGGTGTGGCGTGGTTAAGTTCGAG
TCGCCAGAGGTGGCCGAGAGAGCCTGCCGGATGATGAATGGCATGAAGCTGAGTGGCCGAGAGATTGACG
TTCGAATTGATAGAAACGCTTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_005968 unedited
AATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGANAAAATGGCGGCAGGNG
GTCGAAGCGGCGGCGGAGGTGGCGGCGACGGAGATCAAAATGGAGGAAGAGAGCGGCGCG
CCCGGCGTGCCGAGCGGCAACGGGGCTCCGGGCCCTAAGGGTGAAGGAGAACGACCTGCT
CAGAATGAGAAGAGGAAGGAGAAAAACATAAAAAGAGGAGGCAATCGCTTTGAGCCATAT
GCCAATCCAACTAAAAGATACAGAGCCTTCATTACAAACATACCTTTTGATGTGAAATGG
CAGTCACTTAAAGACCTGGTTAAAGAAAAAGTTGGTGAGGTAACATACGTGGAGCTCTTA
ATGGACGCTGAAGGAAAGTCAAGGGGATGTGCTGTTGTTGAATTCAAGATGGAAGAGAGC
ATGAAAAAAGCTGCGGAAGTCCTAAACAAGCATAGTCTGAGCGGAAGACCACTGAAAGTC
AAAGAAGATCCTGATGGTGAACATGCCAGGAGAGCAATGCAAAAGGTGATGGCTACGACT
GGTGGGATGGGTATGGGACCAGGTGGCCCAGGAATGATTACTATCCCACCCAGTATCCTA
AATAATCCCAACATCCCAAATGAGATTATCCATGCATTACAGGCTGGAAGACTTGGAAGC
ACAGTATTTGTAGCAAATCTGGATTATAAAGTTGGCTGGAAGAAACTGAAGGAAGTATTT
AGTATGGGCTGGGTGTGGTGGTCCGAGCANACATTCTTGAGATAAAGATGGAAAAGTCGT
GGATAGGCACTGTTACTTTTGAACAGTCATTGAAGCTGTGCAGCCTTATCTATGTTCAAT
GGCCAGCTGCTATTTGAAGACCAATGCCGTCAGATGGATGAAAGGGNCCTACAAAAGGNA
GATTCTTCCTNCTGAGCGTCACAACACTNCCCATGGNNCTGGNGGNNATGNCATGGGGTA
GGACAGNAGGGCANCCCATGTGGCCATCCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005968 unedited
NNNTTTCTTTGGACCCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTCAGG
AACCGGTATTTATTATCAAAGTCATATTCGATGTCAACAAGATGCCACAACTACAAAAAA
AATTGCGCACATTGCAATCTCAATGCAAACAGTCAAATGGAACCCCAGTCATTAAAAAAG
TAATTCAAATTACCCCAAAAAGCAACTGAATTTTTTAAACATCTTTATACATCCAGCCAA
CAAATTAAAATGGTTAACAAGAAAAAATACAAATTCAGAGGTCTCGTATCGATGTTTAAA
AAAGGCAACTGCTTAAGCGTTTCTATCAATTCGAACGTCAATCTCTCGGCCACTCAGCTT
CATGCCATTCATCATCCGGCAGGCTCTCTCGGCCACCTCTGGCGACTCGAACTTAACCAC
ACCACACCCCTTGGACTTCCCATTCTCCATCTTGATGTCGGCGTACAGCACGTGGCCGCA
CTCGTTGAATTTGTCCTTTAGCATCTTCCATGTGAAATCGAATGGCAGATTTCTCACAAA
TATCTGGCAGGCCTTCCTGGCCACCCCAGGAGCATGGCCTCCAGCTCCACCAAAGGAACC
TGCGAAGCTTCCTCCGAAGTTGCCACGCTCCATCTCGATGGCACGGTCAAAGCTGGCACC
GNCACCGCCACCCATGGCCAGGCCCATGCGCTCAATGCCAGCGCCCAGGGCCGGGCCCAT
GGCGGGGCCCATGCGCTCGAAGCTGTTGGGACCCATGCGCTNCAGGCCCATGCGCTCGAG
GCTGTTGGCGCCCATGCGCTCCAGGCCATTCGCTTCAAATTGTTGCGGCCATGCGCTTCA
GCCGGGGGCCATGCGATCATAACGGGGCCCTGCCTCCAGGCAGTTCCATACCTGGGGCAC
CATGCGCTCATGCCAGGCCAGCCCTTATGGAAGGCCCTGCCA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005968
ORF Size 2547 bp
Insert Size 2350
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005968.2, NP_005959
RefSeq Size 2547
Locus ID 4670
Cytogenetics 19p13.2
Domains RRM
Protein Families Druggable Genome
Protein Pathways Spliceosome
Gene Summary This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs. This protein also constitutes a monomer of the N-acetylglucosamine-specific receptor which is postulated to trigger selective recycling of immature GlcNAc-bearing thyroglobulin molecules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011].
Transcript Variant: This variant (1) encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.