OBFC1 (STN1) (NM_024928) Human Untagged Clone

CAT#: SC111636

OBFC1 (untagged)-Human oligonucleotide/oligosaccharide-binding fold containing 1 (OBFC1)


  "NM_024928" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
OBFC1 mouse monoclonal antibody, clone OTI2E4 (formerly 2E4)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "OBFC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OBFC1
Synonyms AAF-44; AAF44; bA541N10.2; OBFC1; RPA-32
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_024928 edited
CAGCCAACTGCTCCTGCGCCGGGCGGGGTCGTCGCCGCCAGCGGCTCCGAGCGCCGGAAG
GGCCAGGTCGCAGGGCTCCTGGAGCTGCAGGCGGCGGGAGGGGCTACAAATGCTTGACTC
AGTGATGCAGAACCTTTCAGAGTTAGCTGGAAGCCACAGCCCTGCCTCTTGATGCAGCCT
GGATCCAGCCGGTGTGAAGAGGAGACCCCTTCCCTCTTGTGGGGTTTGGATCCTGTGTTT
CTAGCCTTTGCAAAACTCTACATCAGGGATATCCTGGACATGAAGGAGTCCCGCCAGGTG
CCAGGTGTATTTTTGTACAATGGACATCCAATAAAACAGGTAGATGTCTTGGGAACTGTC
ATTGGAGTGAGAGAAAGAGATGCTTTCTACAGTTATGGAGTGGATGACAGCACTGGAGTT
ATAAACTGCATCTGCTGGAAAAAGTTGAATACTGAGTCTGTATCAGCTGCTCCTAGTGCA
GCAAGAGAGCTCAGCTTAACCTCACAACTTAAGAAGCTACAAGAGACCATTGAGCAGAAA
ACAAAGATAGAGATCGGGGACACGATCCGAGTCAGAGGCAGTATCCGCACATACAGAGAA
GAGCGAGAGATTCATGCCACCGCTTACTATAAAGTGGACGACCCAGTGTGGAACATTCAA
ATTGCAAGGATGCTTGAGCTGCCCACTATCTACAGGAAAGTTTATGACCAGCCTTTTCAC
AGCTCAGCCCTAGAGAAAGAAGAGGCACTAAGCAATCCAGGCGCCCTGGACCTCCCCAGT
CTCACGAGTTTGCTGAGTGAAAAAGCCAAAGAATTCCTCATGGAGAACAGAGTGCAGAGC
TTTTACCAGCAGGAGCTGGAAATGGTGGAGTCTTTGCTGTCCCTTGCCAATCAGCCTGTG
ATTCACAGTGCCTGCTCCGACCAAGTGAATTTTAAGAAGGACACCACTTCCAAGGCAATT
CATAGTATATTTAAGAATGCTATACAACTGCTGCAGGAAAAAGGACTTGTTTTCCAGAAA
GATGATGGTTTTGATAACCTATACTATGTAACCAGAGAAGACAAAGACCTGCACAGAAAG
ATCCACCGGATCATTCAGCAGGACTGCCAGAAACCAAATCACATGGAGAAGGGCTGTCAC
TTCCTGCACATCTTGGCCTGTGCTCGCCTGAGCATCCGCCCGGGCCTGAGCGAGGCTGTG
CTGCAGCAAGTTCTGGAGCTCCTGGAGGACCAGAGTGACATTGTCAGCACAATGGAGCAC
TACTACACAGCGTTCTGAGCAGAGACACGCAGACCAGCTGAGGAGGACAAAGATAAGGTG
GCATTCACCCCCAGGCTCTGACTTTCAGCATCATGCAGGGGCTTATCTGTCTGGAGGCAG
TTACCTCATAATAAACTATAAAATATAGTCATCTTGGGAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAA
>OriGene 5' read for NM_024928 unedited
AACTCATAANTGTAAACGACTTACTATAGGCGGCCGCGAATTCGCACGAGGCAGCCAACT
GCTCCTGCGCCGGGCGGGGTCGTCGCCGCCAGCGGCTCCGAGCGCCGGAAGGGCCAGGTC
GCAGGGCTCCTGGAGCTGCAGGCGGCGGGAGGGGCTACAAATGCTTGACTCAGTGATGCA
GAACCTTTCAGAGTTAGCTGGAAGCCACAGCCCTGCCTCTTGATGCAGCCTGGATCCAGC
CGGTGTGAAGAGGAGACCCCTTCCCTCTTGTGGGGTTTGGATCCTGTGTTTCTAGCCTTT
GCAAAACTCTACATCAGGGATATCCTGGACATGAAGGAGTCCCGCCAGGTGCCAGGTGTA
TTTTTGTACAATGGACATCCAATAAAACAGGTAGATGTCTTGGGAACTGTCATTGGAGTG
AGAGAAAGAGATGCTTTCTACAGTTATGGAGTGGATGACAGCACTGGAGTTATAAACTGC
ATCTGCTGGAAAAAGTTGAATACTGAGTCTGTATCAGCTGCTCCTAGTGCAGCAAGAGAG
CTCAGCTTAACCTCACAACTTAAGAAGCTACAAGAGACCATTGAGCAGAAAACAAAGATA
GAGATCGGGGACACGATCCGAGTCAGAGGCAGTATCCGCACATACAGAGAAGAGCGAGAG
ATTCATGCCACCGCTTACTATAAAGTGGACGACCCAGTGTGGAACATTCAAATTGCAAGG
ATGCTTGAGCTGCCCACTATCTACAGGGAAGTTTATGACCAGCCTTTTCACAGCTCAGCC
CTAGAGAAAGAAGAGCACTAAGCAATCCAGGCGCCCTGGACCTNCCCAGTCTCACGAGTT
TGCTGAGTGAAAAGCCAAAGATTCCTCATGAGAACAGAGTGCAGAGCTTTTACAGCAGAG
CTGGAATGGNNGNAGTCTTGCTGTCCTTTGCAATCAGCCTGTGATCACAGTGCCG
Restriction Sites Please inquire     
ACCN NM_024928
Insert Size 1460 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_024928.3, NP_079204.1
RefSeq Size 1451 bp
RefSeq ORF 1107 bp
Locus ID 79991
UniProt ID Q9H668
Cytogenetics 10q24.33
Gene Summary OBFC1 and C17ORF68 (MIM 613129) are subunits of an alpha accessory factor (AAF) that stimulates the activity of DNA polymerase-alpha-primase (see MIM 176636), the enzyme that initiates DNA replication (Casteel et al., 2009 [PubMed 19119139]). OBFC1 also appears to function in a telomere-associated complex with C17ORF68 and TEN1 (C17ORF106; MIM 613130) (Miyake et al., 2009 [PubMed 19854130]).[supplied by OMIM, Nov 2009]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.