Citrate synthetase(CS) (NM_004077) Human Untagged Clone

CAT#: SC111616

CS (untagged)-Human citrate synthase (CS), nuclear gene encoding mitochondrial protein

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Citrate synthetase(CS) (NM_004077) Human Untagged Clone
Symbol CS
Synonyms citrate synthase, mitochondrial; citrate synthase
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111616 sequence for NM_004077 edited (data generated by NextGen Sequencing)
ATGGCTTTACTTACTGCGGCCGCCCGGCTCTTGGGAACCAAGAATGCATCTTGTCTTGTT
CTTGCAGCCCGGCATGCCAGTGCTTCCTCCACGAATTTGAAAGACATATTGGCTGACCTG
ATACCTAAGGAGCAGGCCAGAATTAAGACTTTCAGGCAGCAACATGGCAAGACGGTGGTG
GGCCAAATCACTGTGGACATGATGTATGGTGGCATGAGAGGCATGAAGGGATTGGTCTAT
GAAACATCAGTTCTTGATCCTGATGAGGGCATCCGTTTCCGAGGCTTTAGTATCCCTGAA
TGCCAGAAACTGCTACCCAAGGCTAAGGGTGGGGAAGAACCCCTGCCTGAGGGCTTATTT
TGGCTGCTGGTAACTGGACATATCCCAACAGAGGAACAGGTATCTTGGCTCTCAAAAGAG
TGGGCAAAGAGGGCAGCTCTGCCTTCCCATGTGGTCACCATGCTGGACAACTTTCCCACC
AATCTACACCCCATGTCTCAGCTCAGTGCAGCTGTTACAGCCCTCAACAGTGAAAGTAAC
TTTGCCCGAGCATATGCACAGGGTATCAGCCGAACCAAGTACTGGGAGTTGATTTATGAA
GACTCTATGGATCTAATCGCAAAGCTACCTTGTGTTGCAGCAAAGATCTACCGAAATCTC
TACAGAGAAGGCAGCGGTATTGGGGCCATTGACTCTAACCTGGACTGGTCTCACAATTTC
ACCAACATGTTAGGCTATACTGATCATCAGTTCACTGAGCTCACGCGCCTGTACCTCACC
ATCCACAGTGACCATGAGGGTGGCAATGTAAGTGCCCATACCAGCCATTTGGTGGGCAGT
GCCCTTTCCGACCCTTACCTGTCCTTTGCAGCAGCCATGAACGGGCTGGCAGGGCCTCTC
CATGGACTGGCAAATCAGGAAGTGCTTGTCTGGCTAACACAGCTGCAGAAGGAAGTTGGC
AAAGATGTGTCAGATGAGAAGTTACGAGACTACATCTGGAACACACTCAACTCAGGACGG
GTTGTTCCAGGCTATGGCCATGCAGTACTAAGGAAGACTGATCCGCGATATACCTGTCAG
CGAGAGTTTGCTCTGAAACACCTGCCTAATGACCCCATGTTTAAGTTGGTTGCTCAGCTG
TACAAGATTGTGCCCAATGTCCTCTTAGAGCAGGGTAAAGCCAAGAATCCTTGGCCCAAT
GTAGATGCTCACAGTGGGGTGCTGCTCCAGTATTATGGCATGACGGAGATGAATTACTAC
ACGGTCCTGTTTGGGGTGTCACGAGCATTGGGTGTACTGGCACAGCTCATCTGGAGCCGA
GCCTTAGGCTTCCCTCTAGAAAGGCCCAAGTCCATGAGCACAGAGGGTCTGATGAAGTTT
GTGGACTCTAAGTCAGGGTAA

Clone variation with respect to NM_004077.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004077 unedited
NNNNNNNNCCCCNNGGCCACCNNNNNCNGGTCCGAGATTTGTATACGACTCCTATAGGCG
GCCGCGNAATTCGCACCAGTCGGCGCGGCCTCTGGTGCAGCGGCGGCGGCTCCTGTTCCT
GCCGCAGCTCTCTCCCTTTCTTACCTCCCCACCAGATCCCGGAGATCGCCCGCCATGGCT
TTACTTACTGCGGCCGCCCGGCTCTTGGGAACCAAGAATGCATCTTGTCTTGTTCTTGCA
GCCCGGCATGCCAGTGCTTCCTCCACGAATTTGAAAGACATATTGGCTGACCTGATACCT
AAGGAGCAGGCCAGAATTAAGACTTTCAGGCAGCAACATGGCAAGACGGTGGTGGGCCAA
ATCACTGTGGACATGATGTATGGTGGCATGAGAGGCATGAAGGGATTGGTCTATGAAACA
TCAGTTCTTGATCCTGATGAGGGCATCCGTTTCCGAGGCTTTAGTATCCCTGAATGCCAG
AAACTGCTACCCAAGGCTAAGGGTGGGGAAGAACCCCTGCCTGAGGGCTTATTTTGGCTG
CTGGTAACTGGACATATCCCAACAGAGGAACAGGTATCTTGGCTCTCAAAAGAGTGGGCA
AAGAGGGCAGCTCTGCCTTCCCATGTGGTCACCATGCTGGACAACTTTCCCACCAATCTA
CACCCCATGTCTCAGCTCAGTGCAGCTGTTACAGCCCTCAACAGTGAAAGTAACTTTGCC
CGAGCATATGCACAGGGTATCAGCCGAACCAAGTACTGGGAGTTGATTTATGAAGACTCT
ATGGATCTAATCGCANAGCTACCTTTGTGTGCAGCANAGATCTACCGAAATCTCTACAGA
GAAGCAGCGGTATTGGGGCCATTGACTCTAACTGGACTGGTCTCACAATTTCACCACATG
TTAGGCTATACTGATCATCAGTTCACTGAGCTCACGCGCCTGTACCTCACATNCACAGTG
ACCATGAGGGTGGGCAATGTTAAGTGCCATN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004077 unedited
TTTTTTTTTTTTTTGTTAATAAAAACATTTATTTTGCATTTTATACAGAACAACCTGAAG
TCTCCATCATGACTTGACAGTTACCCAGGGGTTTACAGTGTGTCCAACTCAACAGTGTGG
TTCTGGGACTGGGTATCCACACAAACACAGGCAGGAGTTTGGAGGAAAGATGGGGGCACA
GCAGGAGTGTATCTTAATCCTTTCTCAAAGAAAAAGAAGTAGAGCATTCTGAGTTGCTGA
AAACCTGTGCAAATGGGGCTTCTGAAACATTGTACTGTGAGCTCTCAGGGAAAGGGAGGA
AAAAGATGTTGATAAATAAGGAGGCAATTTCTTGAGGCAGGGGACGAGGAGGGAGGCTTA
CTATTTTTAATGCCCTCAGCCCCAGTACCTGATAATCAGAGGAGACCATGTCCAATCTTG
AATCAATTCCCTGTTCAAAAAGAGGTGCTAATACCCCGGGGACAAGACTCTGAAAATATC
ATGCTGGTCATTCCGGAGTTCTATGCCCCACAGCATATTAAAAATGGGGTTGTGGGGGGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004077
ORF Size 1401 bp
Insert Size 2800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004077.2, NP_004068
RefSeq Size 2997
RefSeq ORF 1401
Locus ID 1431
Cytogenetics 12q13.3
Domains citrate_synt
Protein Pathways Citrate cycle (TCA cycle), Glyoxylate and dicarboxylate metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene is a Krebs tricarboxylic acid cycle enzyme that catalyzes the synthesis of citrate from oxaloacetate and acetyl coenzyme A. The enzyme is found in nearly all cells capable of oxidative metablism. This protein is nuclear encoded and transported into the mitochondrial matrix, where the mature form is found. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.