Amyloid Precursor Protein(APP) (NM_000484) Human Untagged Clone

CAT#: SC111589

APP (untagged)-Human amyloid beta (A4) precursor protein (APP), transcript variant 1

USD 1,473.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Amyloid Precursor Protein(APP) (NM_000484) Human Untagged Clone
Symbol APP
Synonyms AAA; ABETA; ABPP; AD1; APPI; CTFgamma; CVAP; PN-II; PN2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000484 edited
CTCTGAGCCCCGCCGCCGCGCTCGGGCTCCGTCAGTTTCCTCGGCAGCGGTAGGCGAGAG
CACGCGGAGGAGCGTGCGCGGGGGCCCCGGGAGACGGCGGCGGTGGCGGCGCGGGCAGAG
CAAGGACGCGGCGGATCCCACTCGCACAGCAGCGCACTCGGTGCCCCGCGCAGGGTCGCG
ATGCTGCCCGGTTTGGCACTGCTCCTGCTGGCCGCCTGGACGGCTCGGGCGCTGGAGGTA
CCCACTGATGGTAATGCTGGCCTGCTGGCTGAACCCCAGATTGCCATGTTCTGTGGCAGA
CTGAACATGCACATGAATGTCCAGAATGGGAAGTGGGATTCAGATCCATCAGGGACCAAA
ACCTGCATTGATACCAAGGAAGGCATCCTGCAGTATTGCCAAGAAGTCTACCCTGAACTG
CAGATCACCAATGTGGTAGAAGCCAACCAACCAGTGACCATCCAGAACTGGTGCAAGCGG
GGCCGCAAGCAGTGCAAGACCCATCCCCACTTTGTGATTCCCTACCGCTGCTTAGTTGGT
GAGTTTGTAAGTGATGCCCTTCTCGTTCCTGACAAGTGCAAATTCTTACACCAGGAGAGG
ATGGATGTTTGCGAAACTCATCTTCACTGGCACACCGTCGCCAAAGAGACATGCAGTGAG
AAGAGTACCAACTTGCATGACTACGGCATGTTGCTGCCCTGCGGAATTGACAAGTTCCGA
GGGGTAGAGTTTGTGTGTTGCCCACTGGCTGAAGAAAGTGACAATGTGGATTCTGCTGAT
GCGGAGGAGGATGACTCGGATGTCTGGTGGGGCGGAGCAGACACAGACTATGCAGATGGG
AGTGAAGACAAAGTAGTAGAAGTAGCAGAGGAGGAAGAAGTGGCTGAGGTGGAAGAAGAA
GAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAA
CCCTACGAAGAAGCCACAGAGAGAACCACCAGCATTGCCACCACCACCACCACCACCACA
GAGTCTGTGGAAGAGGTGGTTCGAGAGGTGTGCTCTGAACAAGCCGAGACGGGGCCGTGC
CGAGCAATGATCTCCCGCTGGTACTTTGATGTGACTGAAGGGAAGTGTGCCCCATTCTTT
TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG
TGTGGCAGCGCCATGTCCCAAAGTTTACTCAAGACTACCCAGGAACCTCTTGCCCGAGAT
CCTGTTAAACTTCCTACAACAGCAGCCAGTACCCCTGATGCCGTTGACAAGTATCTCGAG
ACACCTGGGGATGAGAATGAACATGCCCATTTCCAGAAAGCCAAAGAGAGGCTTGAGGCC
AAGCACCGAGAGAGAATGTCCCAGGTCATGAGAGAATGGGAAGAGGCAGAACGTCAAGCA
AAGAACTTGCCTAAAGCTGATAAGAAGGCAGTTATCCAGCATTTCCAGGAGAAAGTGGAA
TCTTTGGAACAGGAAGCAGCCAACGAGAGACAGCAGCTGGTGGAGACACACATGGCCAGA
GTGGAAGCCATGCTCAATGACCGCCGCCGCCTGGCCCTGGAGAACTACATCACCGCTCTG
CAGGCTGTTCCTCCTCGGCCTCGTCACGTGTTCAATATGCTAAAGAAGTATGTCCGCGCA
GAACAGAAGGACAGACAGCACACCCTAAAGCATTTCGAGCATGTGCGCATGGTGGATCCC
AAGAAAGCCGCTCAGATCCGGTCCCAGGTTATGACACACCTCCGTGTGATTTATGAGCGC
ATGAATCAGTCTCTCTCCCTGCTCTACAACGTGCCTGCAGTGGCCGAGGAGATTCAGGAT
GAAGTTGATGAGCTGCTTCAGAAAGAGCAAAACTATTCAGATGACGTCTTGGCCAACATG
ATTAGTGAACCAAGGATCAGTTACGGAAACGATGCTCTCATGCCATCTTTGACCGAAACG
AAAACCACCGTGGAGCTCCTTCCCGTGAATGGAGAGTTCAGCCTGGACGATCTCCAGCCG
TGGCATTCTTTTGGGGCTGACTCTGTGCCAGCCAACACAGAAAACGAAGTTGAGCCTGTT
GATGCCCGCCCTGCTGCCGACCGAGGACTGACCACTCGACCAGGTTCTGGGTTGACAAAT
ATCAAGACGGAGGAGATCTCTGAAGTGAAGATGGATGCAGAATTCCGACATGACTCAGGA
TATGAAGTTCATCATCAAAAATTGGTGTTCTTTGCAGAAGATGTGGGTTCAAACAAAGGT
GCAATCATTGGACTCATGGTGGGCGGTGTTGTCATAGCGACAGTGATCGTCATCACCTTG
GTGATGCTGAAGAAGAAACAGTACACATCCATTCATCATGGTGTGGTGGAGGTTGACGCC
GCTGTCACCCCAGAGGAGCGCCACCTGTCCAAGATGCAGCAGAACGGCTACGAAAATCCA
ACCTACAAGTTCTTTGAGCAGATGCAGAACTAGACCCCCGCCACAGCAGCCTCTGAAGTT
GGACAGCAAAACCATTGCTTCACTACCCATCGGTGTCCATTTATAGAATAATGTGGGAAG
AAACAAACCCGTTTTATGATTTACTCATTATCGCCTTTTGACAGCTGTGCTGTAACACAA
GTAGATGCCTGAACTTGAATTAATCCACACATCAGTAATGTATTCTATCTCTCTTTACAT
TTTGGTCTCTATACTACATTATTAATGGGTTTTGTGTACTGTAAAGAATTTAGCTGTATC
AAACTAGTGCATGAATAGATTCTCTCCTGATTATTTATCACATAGCCCCTTAGCCAGTTG
TATATTATTCTTGTGGTTTGTGACCCAATTAAGTCCTACTTTACATATGCTTTAAGAATC
GATGGGGGATGCTTCATGTGAACGTGGGAGTTCAGCTGCTTCTCTTGCCTAAGTATTCCT
TTCCTGATCACTATGCATTTTAAAGTTAAACATTTTTAAGTATTTCAGATGCTTTAGAGA
GATTTTTTTTCCATGACTGCATTTTACTGTACAGATTGCTGCTTCTGCTATATTTGTGAT
ATAGGAATTAAGAGGATACACACGTTTGTTTCTTCGTGCCTGTTTTATGTGCACACATTA
GGCATTGAGACTTCAAGCTTTTCTTTTTTTGTCCACGTATCTTTGGGTCTTTGATAAAGA
AAAGAATCCCTGTTCATTGTAAGCACTTTTACGGGGCGGGTGGGGAGGGGTGCTCTGCTG
GTCTTCAATTACCAAGAATTCTCCAAAACAATTTTCTGCAGGATGATTGTACAGAATCAT
TGCTTATGACATGATCGCTTTCTACACTGTATTACATAAATAAATTAAATAAAATAAAAA
AAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000484 unedited
TACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCTCTGAGCCCCGCCGCCGCGC
TCGGGCTCCGTCAGTTTCCTCGGCAGCGGTAGGCGAGAGCACGCGGAGGAGCGTGCGCGG
GGGCCCCGGGAGACGGCGGCGGTGGCGGCGCGGGCAGAGCAAGGACGCGGCGGATCCCAC
TCGCACAGCAGCGCACTCGGTGCCCCGCGCAGGGTCGCGATGCTGCCCGGTTTGGCACTG
CTCCTGCTGGCCGCCTGGACGGCTCGGGCGCTGGAGGTACCCACTGATGGTAATGCTGGC
CTGCTGGCTGAACCCCAGATTGCCATGTTCTGTGGCAGACTGAACATGCACATGAATGTC
CAGAATGGGAAGTGGGATTCAGATCCATCAGGGACCAAAACCTGCATTGATACCAAGGAA
GGCATCCTGCAGTATTGCCAAGAAGTCTACCCTGAACTGCAGATCACCAATGTGGTAGAA
GCCAACCAACCAGTGACCATCCAGAACTGGTGCAAGCGGNGCCGCAAGCAGTGCAAGACC
CATCCCCACTTTGTGATTCCCTACCGCTGCTTAGTTGGTGAGTTTGTAAGTGATGCCCTT
CTCGTTCCTGACAAGTGCAAATTCTTACACCAGGAGAGGATGGGATGTNTNGCGAAACTC
ATCTTCACTGGCACACCGTCGCCAAAGAGACATGCAGTGAGAAGAGTACCAACTTGCATG
ACTACGGCATGTTGCTGCCCTGCGGNATTGACAGTNCCGAGGTGACAGTTCTGGGCGCCT
GCCCCTGCCTGNAGAAAGCGACATGCGGCTCCCGCTGTGCGGCACGAGATGCCCACGCAG
CCTGCCGCCCCGTCCTACTCTCCCTTACCCCGTTCTCTCCCCCTCCCCCCCCCTCCTCCC
GCCCCCCCCCCGTCTTTATTACGCGTCCTCCTCTCTCCCTGCATCGTCGTTCCTGGCTGT
ACCCCCCCATCTCACCCACTTCGGCCTTCCTCCG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000484 unedited
CCATCGNGANNGATGGCAACTTCCCAGGTTCAGGAAAGCACTGGGGCAGGGTCACAGGGC
TGCCACCCGGGTTCTGTTCAGGAAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGT
TTTTTTTTTTTTTTTTTATTTTATTTAATTTATTTATGTAATACAGTGTAGAAAGCGATC
ATGTCATAAGCAATGATTCTGTACAATCATCCTGCAAAAAATTGTTTTGGAGAATTCTTG
GTAATTGAAGACCAGCAGAGCACCCCTCCCCACCCGCCCCGTAAAAGTGCTTACAATGAA
CAGGGATTCTTTTCTTTATCAAAGACCCAAAGATACGTGGACAAAAAAAGAAAAGCTTGA
AGTCTCAATGCCTAATGTGTGCACATAAAACAGGCACGAAGAAACAAACGTGTGTATCCT
CTTAATTCCTATATCACAAATATAGCAGAAGCAGCAATCTGTACAGTAAAATGCAGTCAT
GGAAAAAAAATCTCTCTAAAGCATCTGAAATACTTAAAAATGTTTAACTTTAAAATGCAT
AGTGATCAGGAAAGGAATACTTAGGCAAGAGAAGCAGCTGAACTCCCACGTTCACATGAA
GCATCCCCCATCGATTCTTAAAGCATATGTAAAGTAAGACTTAATTGGGTCACACACCAC
AAGAATAATATACAACTGGCTAAGGGGCTATGTGATAAATAATCAGGAAAGAATCCTTTC
CTGCCCTAGTTTGATACAGCTAAATTCTTTACGGTCACCAAACCCTTTTTTTATTGTTTT
TTGAGCCCAATTGTAAGGGGGGGTGGAATCCCTTCCGGGTGTGTGGTTCCATTCAGGGTT
AGCTTTTTTTTGTTTTCACTCCCTCTGCCCATGGCGNTTTTGTGTAACCCTAAAAAGGGC
GTTTTCTTCCCCCTTTTTCTTTGAGGGCCCAAAGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000484
ORF Size 2313 bp
Insert Size 3600
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000484.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000484.2, NP_000475
RefSeq Size 3641
Locus ID 351
Cytogenetics 21q21.3
Domains Beta-APP, KU, A4_EXTRA
Protein Families Transmembrane, Druggable Genome
Protein Pathways Alzheimer's disease
Gene Summary This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. In addition, two of the peptides are antimicrobial peptides, having been shown to have bacteriocidal and antifungal activities. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2014].
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a, also known as PreA4 770).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.