ABCB10 (NM_012089) Human Untagged Clone

CAT#: SC111206

ABCB10 (untagged)-Human ATP-binding cassette, sub-family B (MDR/TAP), member 10 (ABCB10), nuclear gene encoding mitochondrial protein

USD 721.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ABCB10 (NM_012089) Human Untagged Clone
Symbol ABCB10
Synonyms EST20237; M-ABC2; MTABC2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_012089, the custom clone sequence may differ by one or more nucleotides


ATGCGAGGCCCCCCTGCCTGGCCGCTGCGGCTGCTCGAGCCACCGAGCCCTGCCGAGCCAGGTCGGCTCC
TGCCGGTAGCCTGCGTGTGGGCCGCGGCCAGCCGCGTTCCCGGGTCCCTATCGCCGTTCACTGGCCTGAG
GCCGGCGCGGCTATGGGGCGCGGGGCCCGCGCTGCTCTGGGGCGTTGGAGCCGCGCGCCGCTGGAGGAGC
GGCTGCCGGGGCGGGGGTCCGGGCGCCTCGCGGGGCGTCCTGGGCCTCGCGCGGCTCCTGGGGCTGTGGG
CTCGCGGCCCCGGCAGCTGCAGGTGCGGGGCTTTTGCCGGGCCAGGCGCTCCTCGGCTCCCGCGCGCCCG
GTTCCCGGGCGGTCCCGCAGCCGCTGCCTGGGCAGGGGACGAGGCCTGGCGGCGCGGGCCGGCGGCGCCT
CCCGGGGACAAGGGGCGGCTGCGCCCCGCAGCGGCCGGACTCCCGGAGGCCCGGAAGCTCCTGGGGCTGG
CGTACCCTGAGCGCCGGAGGCTGGCAGCTGCGGTTGGATTTCTCACGATGTCCAGTGTTATCTCCATGTC
TGCCCCTTTCTTCCTGGGGAAGATCATTGATGTCATCTATACCAACCCCACTGTGGACTACAGCGACAAC
CTGACCCGCCTCTGCCTAGGGCTCAGTGCCGTGTTTCTGTGTGGTGCTGCCGCCAATGCCATTCGTGTCT
ACCTCATGCAAACTTCAGGTCAGCGCATTGTGAATAGGCTGAGAACTTCATTATTCTCCTCCATTCTGAG
GCAGGAGGTTGCTTTCTTTGACAAGACTCGCACAGGAGAATTGATTAACCGCCTCTCATCAGACACTGCA
CTCCTGGGGCGCTCAGTGACTGAAAACCTCTCAGATGGGCTCAGGGCCGGGGCCCAGGCTTCCGTAGGCA
TCAGTATGATGTTTTTTGTCTCACCTAATCTGGCCACCTTTGTTTTGAGCGTGGTGCCTCCAGTGTCAAT
CATTGCTGTAATTTATGGGCGATATCTACGGAAACTGACCAAAGTCACTCAGGATTCCCTGGCACAAGCC
ACTCAGCTAGCTGAGGAACGTATTGGAAATGTAAGAACTGTTCGAGCTTTTGGGAAAGAAATGACTGAAA
TCGAGAAATATGCCAGCAAAGTGGACCATGTAATGCAGTTAGCAAGGAAAGAGGCATTCGCCCGGGCTGG
TTTCTTTGGAGCAACTGGGCTCTCCGGAAACCTGATCGTGCTTTCTGTCCTGTACAAAGGAGGGCTGCTG
ATGGGCAGTGCCCACATGACCGTGGGTGAACTCTCTTCCTTCCTAATGTATGCTTTCTGGGTTGGAATAA
GCATTGGAGGTCTGAGCTCTTTCTACTCGGAGCTGATGAAAGGACTGGGTGCAGGGGGGCGCCTCTGGGA
GCTCCTGGAGAGAGAGCCCAAGCTGCCTTTTAACGAGGGGGTCATCTTAAATGAGAAAAGCTTCCAGGGT
GCTTTGGAGTTTAAGAACGTGCATTTTGCCTATCCAGCTCGCCCAGAGGTGCCCATATTTCAGGATTTCA
GCCTTTCCATTCCGTCAGGATCTGTCACGGCACTGGTTGGCCCAAGTGGTTCTGGCAAATCAACAGTGCT
TTCACTCCTGCTGAGGTTGTACGACCCTGCTTCTGGAACTATTAGTCTTGATGGCCATGACATCCGTCAG
CTAAACCCAGTGTGGCTGAGATCCAAAATTGGGACAGTGAGTCAGGAACCCATTTTGTTTTCTTGCTCTA
TTGCTGAGAACATTGCTTATGGTGCTGATGACCCTTCCTCTGTGACCGCTGAGGAAATCCAGAGAGTGGC
TGAAGTGGCCAATGCAGTGGCCTTCATCCGGAATTTCCCCCAAGGGTTCAACACTGTGGTTGGAGAAAAG
GGTGTTCTCCTCTCAGGTGGGCAGAAACAGCGGATTGCGATTGCCCGTGCTCTGCTAAAGAATCCCAAAA
TTCTTCTCCTAGATGAAGCAACCAGTGCGCTGGATGCCGAAAATGAGTACCTTGTTCAAGAAGCTCTAGA
TCGACTGATGGATGGAAGAACGGTGTTAGTTATTGCCCATCGTCTGTCCACCATTAAGAATGCTAATATG
GTTGCTGTTCTTGACCAAGGAAAAATTACTGAATATGGAAAACATGAAGAGCTGCTTTCAAAACCAAATG
GGATATACAGAAAACTAATGAACAAACAAAGTTTTATTTCAGCATAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_012089 unedited
AGGCGGTACCGATTTTGTAATACCACTTATCTATAGGGCGGCACGGAACTTCGGCACGAG
GCAAGGTCCGGTTAGCTGCAGTCCCCGGTGTGGGGCGGAGAGGCGCGGCACCGCGCGGAC
GAGGATGGGGCGGGGGCGGGCGCAGCCCGAGGGTGCAGGCACGATAAGGCGGGTGACAGC
CAGCGGGGAGGGGCGGGCGCCACCGCGTCCACGCCCTTTGCTCGGGGCCGGGCCGGGAGG
GTCCTCGGGCTTTGCGCGCGCCTGGCCGGCGGGCTGAGGCGTACGGGTCGCACGCAGCGC
CATGCGAGGCCCCCCTGCCTGGCCGCTGCGGCTGCTCGAGCCACCGAGCCCTGCCGAGCC
AGGTCGGCTCCTGCCGGTAGCCTGCGTGTGGGCCGCGGCCAGCCGCGTTCCCGGGTCCCT
ATCGCCGTTCACTGGCCTGAGGCCGGCGCGGCTATGGGGCGCGGGGCCCGCGCTGCTCTG
GGGCGTTGGAGCCGCGCGCCGCTGGAGGAGCGGCTGCCGGGGCGGGGGTCCGGGCGCCTC
GCGGGGCGTCCTGGGCCTCGCGCGGCTCCTGGGGCTGTGGGCTCGCGGCCCCGGCAGCTG
CAGGTGCGGGGCTTTTGCCGGGCCAGGCGCTCCTCGGCTCCCGCGCGCCCGGTTCCCGGG
CGGTCCCGCAGCCGCTGCCTGGGCAGGGGACGAGGCCTGGCGGCGCGGGCCGGCGGCGCC
TCCCGGGGACAAGGGGCGGCTGCGCCCCGCAGCGGCCGGACTCCCGGAGGCCCGGGAGCT
CCTGGGGCTGGCGTACCCTGAGCGCCTNAGGCTGGCAGCTGCGGNTGGATTTCTCACGAT
GTCCAGTGTTATCTCCATGTCTGCCCCTTTCTTCTGGGGAAGATCTTGATGTCATCTATA
CAACCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_012089 unedited
TCTGGACCGCGGCACGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTAAAGTTCACTA
TAAATTTTAATCTATGATATAAAAATTACCTAAAGATAAAATTGAACATCACTGTACTCA
GAAAATAAAACATAACAATGAAATGCAATTTCGTAAATACTTCTATGGCACAAGGATTAT
TTTCCTCAGATTCAACCTTGTAATTGTGTTGTTTGCTTTCTGAAAATCACACTTTATAAA
GAACACAAGTAGAGCTTGTTAAAAATGATTGTCACAGATGTACTGTTTACTAATTCAAAG
AACACTATATTCATTCATATCAATTTTATTCATTAATTATGAACAATAAAATATAATATT
CCATGCTTTTCATGAAATAGTGGTTTCTTCTTCCAGTCTAATCAGGGAACTAATAAATGC
TTAGTTCATGGGAAAACTTCCATTTGATTTACATTGACTTAATTACTTCTTAGGGTCTAG
CCTCATCCATGGAGAAAAGGCACTTTTTCTTGAGGCAACAGCAAATTAACAGCACTGATA
CCAAAAATGGCAAAATCAATGGTCTGTACCATTGCTTTAAGAATTTCCGCCACTATCAAT
CNAAACCTTTACCGTAACCCAAAGGGGCTTTATTTATTACCCCCCCTTCCGGAAAGGGAA
ACATTCTAAAGTCTCCCCGCCTTTCTGTCGCCCACTTTATGCCTTCCTTTCCTACCAGCC
CCCGAAGGCTCGCCACTCCCCCTCATTCCCTCACATTTTACCCCTTTCCATCGCACTCCC
ACATTGGTCTACACAGTCGCGGCCATTCTGGCGGGACTTTTTCCATTGTGTCCGACAGGC
CGCCACGAGCCGTCCTCCGTATCTGCTTGCGGGGTACGCGCCGCTCCCAAATCCTACCCG
CGCCCACCGCGTGCGCGCCCGCCGCCCCCCCCTCCACCCTACCTCTTGCACCCCCCGCGC
TTTGTCTTCCCACGTCTGTGCCTCCGCGCCCACCGACTGTTCGCCTCCTCCCTCCACCCA
CCTCATAGTATT
Restriction Sites ECoRI-NOT     
Tag Tag Free
ACCN NM_012089
ORF Size 2217 bp
Insert Size 4110
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_012089.1, NP_036221
RefSeq Size 3857
Locus ID 23456
Cytogenetics 1q42.13
Domains ABC_membrane, ABC_tran, AAA
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The function of this mitochondrial protein is unknown. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.