GLP2R (NM_004246) Human Untagged Clone

CAT#: SC111108

GLP2R (untagged)-Human glucagon-like peptide 2 receptor (GLP2R)

USD 876


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GLP2R (NM_004246) Human Untagged Clone
Symbol GLP2R
Synonyms OTTHUMP00000160769; glucagon-like peptide 2 receptor
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_004246, the custom clone sequence may differ by one or more nucleotides


ATGAAGCTGGGATCGAGCAGGGCAGGGCCTGGGAGAGGAAGCGCGGGACTCCTGCCTGGCGTCCACGAGC
TGCCCATGGGCATCCCTGCCCCCTGGGGGACCAGTCCTCTCTCCTTCCACAGGAAGTGCTCTCTCTGGGC
CCCTGGGAGGCCCTTCCTCACTCTGGTCCTGCTGGTTTCCATCAAGCAAGTTACAGGATCCCTCCTTGAG
GAAACGACTCGGAAGTGGGCTCAGTACAAACAGGCATGTCTGAGAGACTTACTCAAGGAACCTTCTGGCA
TATTTTGTAACGGGACATTTGATCAGTACGTGTGTTGGCCTCATTCTTCTCCTGGAAATGTCTCTGTACC
CTGCCCTTCATACTTACCTTGGTGGAGTGAAGAGAGCTCAGGAAGGGCCTACAGACACTGCTTGGCTCAG
GGGACTTGGCAGACGATAGAGAACGCCACGGATATTTGGCAGGATGACTCCGAATGCTCCGAGAACCACA
GCTTCAAGCAAAACGTGGACCGTTATGCCTTGCTGTCAACCTTGCAGCTGATGTACACCGTGGGATACTC
CTTCTCTCTTATCTCCCTCTTCCTGGCTCTCACCCTCCTCTTGTTTCTTCGAAAACTCCACTGCACGCGC
AACTACATCCACATGAACTTGTTTGCTTCTTTCATCCTGAGAACCCTGGCTGTACTGGTGAAGGACGTCG
TCTTCTACAACTCTTACTCCAAGAGGCCTGACAATGAGAATGGGTGGATGTCCTACCTGTCAGAGATGTC
CACCTCCTGCCGCTCAGTCCAGGTTCTCTTGCATTACTTTGTGGGTGCCAATTACTTATGGCTGCTGGTT
GAAGGCCTCTACCTCCACACGCTGCTGGAGCCCACAGTGCTTCCTGAGAGGCGGCTGTGGCCCAGATACC
TGCTGTTGGGTTGGGCCTTCCCTGTGCTATTTGTTGTACCCTGGGGTTTCGCCCGTGCACACCTGGAGAA
CACAGGGTGCTGGACAACAAATGGGAATAAGAAAATCTGGTGGATCATCCGAGGACCCATGATGCTCTGT
GTAACAGTCAATTTCTTCATCTTCCTGAAAATTCTCAAGCTTCTCATTTCTAAGCTCAAAGCTCATCAAA
TGTGCTTCAGAGATTATAAATACAGATTGGCAAAATCAACACTGGTCCTCATTCCTTTATTGGGCGTTCA
TGAGATCCTCTTCTCTTTCATCACTGATGATCAAGTTGAAGGATTTGCAAAACTTATACGACTTTTCATT
CAGTTGACACTGAGCTCCTTTCATGGGTTCCTGGTGGCCTTGCAGTATGGTTTTGCCAATGGAGAAGTGA
AGGCTGAGCTGCGGAAATACTGGGTCCGCTTCTTGCTAGCCCGCCACTCAGGCTGCAGAGCCTGTGTCCT
GGGGAAGGACTTCCGGTTCCTAGGAAAATGTCCCAAGAAGCTCTCGGAAGGAGATGGCGCTGAGAAGCTT
CGGAAGCTGCAGCCCTCACTTAACAGTGGGCGGCTCCTACATCTAGCCATGCGAGGTCTTGGGGAGCTGG
GCGCCCAGCCCCAACAGGACCATGCACGCTGGCCCCGGGGCAGCAGCCTGTCCGAGTGCAGTGAGGGGGA
TGTCACCATGGCCAACACCATGGAGGAGATTCTGGAAGAGAGTGAGATCTAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_004246 unedited
GATTTTGTATACGACTCACTATAGGGCGGCCCGCGATTCGGCACGAGCTCAGACACTCTC
GGCGCAGCGTGGAGAGGATTTGTGCAAACATTTCCTCTGTGGACCAAGAGGAATGCAAGA
GGAGGCTGCCTGCGGTGCATCTTGGACGGCTAGAGAGATGTACCCCTACTTGTGAAGGTG
CACGAGGAAGATGAAGCTGGGATCGAGCAGGGCAGGGCCTGGGAGAGGAAGCGCGGGACT
CCTGCCTGGCGTCCACGAGCTGCCCATGGGCATCCCTGCCCCCTGGGGGACCAGTCCTCT
CTCCTTCCACAGGAAGTGCTCTCTCTGGGCCCCTGGGAGGCCCTTCCTCACTCTGGTCCT
GCTGGTTTCCATCAAGCAAGTTACAGGATCCCTCCTTGAGGAAACGACTCGGAAGTGGGC
TCAGTACAAACAGGCATGTCTGAGAGACTTACTCAAGGAACCTTCTGGCATATTTTGTAA
CGGGACATTTGATCAGTACGTGTGTTGGCCTCATTCTTCTCCTGGAAATGTCTCTGTACC
CTGCCCTTCATACTTACCTTGGTGGAGTGAAGAGAGCTCAGGAAGGGCCTACAGACACTG
CTTGGCTCAGGGGACTTGGCAGACGATAGAGAACGCCACGGATATTTGGCAGGATGACTC
CGAGTGCTCCGAGAACCACAGCTTCAAGCAAAACGTGGATCGTTATGCCTTGCTGTCAAC
CTTGCAGCTGATGTACACCGTGGGATACTCCTTCTCTCTTATCTCCCTCTTCCTGGCTCT
CACCCTCCTCTTGNTTCTTCGAAAACTCCACTGCACGCGCAACTACATCCACATGAACTT
GNTTGCTTCTTTCATNCTGAGAACCCTGNCTGTACTGGTGAAGGACGTCGTCTTCTACAA
CTCTACTNCAGAGGCCTGACATGAGATGGNTGGATGTCCTACTGTCAGAGAGTCCACTCC
TGCGCTCAGTCAGNTCTCTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004246
ORF Size 1662 bp
Insert Size 4700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004246.1, NP_004237
RefSeq Size 1662
RefSeq ORF 1662
Locus ID 9340
Cytogenetics 17p13.1
Domains 7tm_2, HormR
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This is a receptor for glucagon-like peptide 2. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.