Cyclin A1(CCNA1) (NM_003914) Human Untagged Clone

CAT#: SC111089

CCNA1 (untagged)-ORIGENE UNIQUE VARIANT 1 of Human cyclin A1 (CCNA1),

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cyclin A1(CCNA1) (NM_003914) Human Untagged Clone
Symbol CCNA1
Synonyms CT146
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_003914, the custom clone sequence may differ by one or more nucleotides


ATGGAGACCGGCTTTCCCGCAATCATGTACCCTGGATCTTTTATTGGGGGCTGGGGAGAAGAGTATCTCA
GCTGGGAAGGACCGGGGCTCCCAGATTTCGTCTTCCAGCAGCAGCCCGTGGAGTCTGAAGCAATGCACTG
CAGCAACCCCAAGAGTGGAGTTGTGCTGGCTACAGTGGCCCGAGGTCCCGATGCTTGTCAGATACTCACC
AGAGCCCCGCTGGGCCAGGATCCCCCGCAGAGGACAGTGCTAGGGCTGCTAACTGCAAATGGGCAGTACA
GGAGGACCTGTGGCCAGGGGATCACAAGAATCAGGTGTTATTCTGGATCAGAAAATGCCTTCCCTCCAGC
TGGAAAGAAAGCACTCCCTGACTGTGGGGTCCAAGAGCCCCCCAAGCAAGGGTTTGACATCTACATGGAT
GAACTAGAGCAGGGGGACAGAGACAGCTGCTCGGTCAGAGAGGGGATGGCATTTGAGGATGTGTATGAAG
TAGACACCGGCACACTCAAGTCAGACCTGCACTTCCTGCTGGATTTCAACACAGTTTCCCCTATGCTGGT
AGATTCATCTCTCCTCTCCCAGTCTGAAGATATATCCAGTCTTGGCACAGATGTGATAAATGTGACTGAA
TATGCTGAAGAAATTTATCAGTACCTTAGGGAAGCTGAAATAAGGCACAGACCCAAAGCACACTACATGA
AGAAGCAGCCAGACATCACGGAAGGCATGCGCACGATTCTGGTGGACTGGCTGGTGGAGGTTGGGGAAGA
ATATAAACTTCGAGCAGAGACCCTGTATCTGGCTGTCAACTTCCTGGACAGGTTCCTTTCATGTATGTCT
GTTCTGAGAGGGAAACTGCAGCTCGTAGGAACAGCAGCTATGCTTTTGGCTTCGAAATATGAAGAGATAT
ATCCTCCTGAAGTAGACGAGTTTGTCTATATCACCGATGATACATACACAAAACGACAACTGTTAAAAAT
GGAACACTTGCTTCTGAAAGTTCTAGCTTTTGATCTGACAGTACCAACCACCAACCAGTTTCTCCTTCAG
TACTTGAGGCGACAAGGAGTGTGCGTCAGGACTGAGAACCTGGCTAAGTACGTAGCAGAGCTGAGTCTAC
TTGAAGCAGATCCATTCTTGAAATATCTTCCTTCACTGATAGCTGCAGCAGCTTTTTGCCTGGCAAACTA
TACTGTGAACAAGCACTTTTGGCCAGAAACCCTTGCTGCATTTACAGGGTATTCATTAAGTGAAATTGTG
CCTTGCCTGAGTGAGCTTCATAAAGCGTACCTTGATATACCCCATCGACCTCAGCAAGCAATTAGGGAGA
AGTACAAGGCTTCAAAGTACCTGTGTGTGTCCCTCATGGAGCCACCTGCAGTTCTTCTTCTACAATAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_003914 unedited
TTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCAGGTTTTGGGGCCT
CCTGTCTGGTGGGAGGAGGCCGCAGCGCAGCACCCTGCTCGTCACTTGGGATGGAGACCG
GCTTTCCCGCAATCATGTACCCTGGATCTTTTATTGGGGGCTGGGGAGAAGAGTATCTCA
GCTGGGAAGGACCGGGGCTCCCAGATTTCGTCTTCCAGGTAACGTGGGTTTAGTATCCCG
ACTTGGAGGCTTGTCAGAATGTTTCTCTCCTTCCAGCCCAACACGAAGTCTTGGGATAAA
AAGCCTCCCTCAGGGATTCAAATAACTGTTTTGATTCAGAGCAACTTTGATCGCCTGTGC
GGTCGCACCTGCCCTTTCAGCCCCAATAATTGCTGGGAAGATCAGCAATTGGTGTTAGTC
CCATTGCTTGGTGCTCTCCCTCCTAGAGGTTCGCTGTGTCCTTGGAGCCCGGGGTGGACG
GAATCGACTAAACAGCTTGTCTGTTTCTCTTTCCCTGGTAGCAGCAGCCCGTGGAGTCTG
AAGCAATGCACTGCAGCAACCCCAAGAGTGNGAGTTGTGCTGGCTACAGTGGCCCGAGGT
CCCGATGCTTGTCAGATACTCACCAGAGCCCCGCTGGGCCAGGATCCCCCGCAGAGGACA
GTGCTAGGGCTGCTAACTGCAAATGGGCAGTACAGGAGGACCTGTGGCCAGNGGATCACA
AGATCANGTGTTATTCTGGATCAGAAATGCCTTCCCTNCACTGGAAGAAAGCCTCCTGAC
TGGTGGGTCCAGAGCCCNNCAGCAGGGGTTGCATCTACTGGATGACTAGACAGGGGACGA
GACGCTGCTCGTCAAGAGGGATGCATTNGAGATGGNATGAATAACACGGCCAT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003914 unedited
TGGACCGCGGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTCATAAGACAAGCA
GTTTATTGTTTAAAAAATGTTGGACTATATTACAAACTACTAAAGTCTAAGGGAAACTAA
ATTCATTTACATTTTTAAAATGTCATCTATATTGTAAACAACATTAGTTGATCCAACGTG
CAGAAGCCTATGACGATTATTGGCACTTCTGATATGGAGGTGAAGTTCTGGAAGTGCTTC
CATTCAAAAACTTATTGTAAAAGAAGAACTGCAGGTGGCTCCATGAGGGACACACACAGG
TACTTTGAAGCCTTGTACTTCTCCCTAATTGCTTGCTGAGGTCGATGGGGTATATCAAGG
TACGCTTTATGAAGCTCACTCAGGCAAGGCACAATTTCACTTAATGAATACCCTGTAAAT
GCAGCAAGGGTTTCTGGCCAAAAGTGCTTGTTCACAGTATAGTTTGCCAGGCAAAAAGCT
GCTGCAGCTATCAGTGAAGGAAGATATTTCAAGAATGGATCTGCTTCAAGTAGACTCAGC
TCTGCTACGTACTTAGCCAGGTTCTCAGTCCTGACGCACACTCCTTGTCGCCTCAAGTAC
TGAAGGAGAAACTGGTTGGTGGTTGGTACTGTCAGATCAAAAGCTAGAACTTTCAGAAGC
AAGTGTTCCATTTTTAACAGTNTGTCGTTTTTGTGTATGTATCATNCGGNNGATATAGAC
AACTCGTCTACTTCAGGGAGATATATCTCTTCATATTTTCGAGCCAAAGCATAGCTGCTG
GTCCTACGAGCTGCAGTTTTCCTTCTCAGACAGACATACATGAAAGGAACCTGTNNCAGA
AAGTGACAGCCAGATACAGGGTCTCTGCTCGAATTTATATTCTTCCCCAACCTCCACCAC
CAGTCACCAGAATCGGGCGATGCCTTNCGGGATGTCTGGT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003914
ORF Size 1398 bp
Insert Size 2000
OTI Disclaimer The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required.
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003914.2, NP_003905
RefSeq Size 1743
Locus ID 8900
Cytogenetics 13q13.3
Domains cyclin_C, CYCLIN, cyclin
Protein Families Druggable Genome
Protein Pathways Cell cycle, Progesterone-mediated oocyte maturation, Pathways in cancer, Acute myeloid leukemia
Gene Summary The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.