Superoxide Dismutase 1(SOD1) (NM_000454) Human Untagged Clone

CAT#: SC111022

SOD1 (untagged)-Human superoxide dismutase 1, soluble (SOD1)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Superoxide Dismutase 1(SOD1) (NM_000454) Human Untagged Clone
Symbol SOD1
Synonyms ALS; ALS1; HEL-S-44; homodimer; hSod1; IPOA; SOD
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111022 sequence for NM_000454 edited (data generated by NextGen Sequencing)
ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAAT
TTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACT
GAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGT
GCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGG
CATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATT
GAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTC
CATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAAC
GCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAA

Clone variation with respect to NM_000454.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000454 unedited
ACCGGTTTTGAAACCGACTCATATAGGCGGCAACCAATTCGCACGAGGTGCTGGTTTGCG
TCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTCGGCG
TGGCCTATCGAGTTATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGC
AGGGCATCATCAATTTCGAGCAGAATGTTTTTTATGGACCAGTGAAGGTGTGGGGAAGCA
TTAAAGGACTGACTGAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAG
CAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAA
AGGATGAAGAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGG
CCGATGTGTCTATTGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCC
GCACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTA
CAAAGACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAAA
CATTCCCTTGGATGTAGTCTGAGGCCCCTTAACTCATCTGTTATCCTGCTAGCTGTAGAA
ATGTATCCTGATAAACATTAAACACTGTAATCTTAAAAGTGTAATTGTGTGACTTTTTCA
GAGTTGCTTTAAAGTACCTGTAGTGAGAAACTGATTTATGATCACTTGGAAGATCTGTAT
AGNTTTATAAAACTCAGTTAAAATGTCTGTTTCAATGACCTGTATTTTGCCACGACTTAA
TCACAGATGGGTATTAAACCTGTCAGAATTTCTTGTCATTCAAGCCTTGAATAAAAAACC
TGTATGGCACTTTTAA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000454 unedited
GTCTGCCCGCGGCCGCATCTAGGTCGGCTTTTTTTTTTTTTTTTTGAATTTGGATTCTTT
TAATAGCCTCATAATAAGTGCCATACAGGGTTTTTATTCACAGGCTTGAATGACAAAGAA
ATTCTGACAAGTTTAATACCCATCTGTGATTTAAGTCTGGCAAAATACAGGTCATTGAAA
CAGACATTTTAACTGAGTTTTATAAAACTATACAAATCTTCCAAGTGATCATAAATCAGT
TTCTCACTACAGGTACTTTAAAGCAACTCTGAAAAAGTCACACAATTACACTTTTAAGAT
TACAGTGTTTAATGTTTATCAGGATACATTTCTACAGCTAGCAGGATAACAGATGAGTTA
AGGGGCCTCAGACTACCTCCACGGGAATGTTTATCGGGCGATCCCAATTACACCACAAGC
CAAACGACTTCCAGCGTTTCCTGTCTTTGCACTTTCTTCATTTTCACCTTTGCCCAAGTC
ATCTGCTTTTTCATGGACCACCAGTGTGCGGCCAATGATGCAATGGTCTCCTGAGAGTGA
GATCACAGAATCTTCACTAGACACATCGGCCACACCATCTTTGTCAGCAGCCACATTGCC
CAAGTCTCCAACATGCCTCTNTTTATCCTTTGGCCCACCGTGTTTTCTGGATAGAGGATC
AAAGTGATGACCCTGTCCTGTCACCGCCTGCTGTATTATCTCCAAACTCATGAACATGGC
ATCCACTGCGGCCCTAACTCACCTCTTTAATGCTTCCCCAACCCTTACTGGCCATTCACT
TCCTTTTTGCTCGACAATGATGAATGCCCTGCCCTGAGCCCGTCGTCCTTTTTCCCCCCC
AACGCACTTTGTTCCCCTCACCTCCGTTTAGCCCCGCCCCAGTTCCTGGCTTCCAGGGAC
TGCAACCGAAACCCCACAACCCTGGAGGAGAATACGAGCCAAACCATATACCGCCGCGCG
CATTCCCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000454
ORF Size 465 bp
Insert Size 940
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000454.4, NP_000445
RefSeq Size 981
RefSeq ORF 465
Locus ID 6647
Cytogenetics 21q22.11
Domains sodcu
Protein Families Druggable Genome
Protein Pathways Amyotrophic lateral sclerosis (ALS), Huntington's disease, Prion diseases
Gene Summary Destroys radicals which are normally produced within the cells and which are toxic to biological systems. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations