PIM1 (NM_002648) Human Untagged Clone

CAT#: SC110975

PIM1 (untagged)-Human pim-1 oncogene (PIM1)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PIM1 (NM_002648) Human Untagged Clone
Symbol PIM1
Synonyms PIM; PIM
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_002648 edited
ATGCTCTTGTCCAAAATCAACTCGCTTGCCCACCTGCGCGCCGCGCCCTGCAACGACCTG
CACGCCACCAAGCTGGCGCCCGGCAAGGAGAAGGAGCCCCTGGAGTCGCAGTACCAGGTG
GGCCCGCTACTGGGCAGCGGCGGCTTCGGCTCGGTCTACTCAGGCATCCGCGTCTCCGAC
AACTTGCCGGTGGCCATCAAACACGTGGAGAAGGACCGGATTTCCGACTGGGGAGAGCTG
CCTAATGGCACTCGAGTGCCCATGGAAGTGGTCCTGCTGAAGAAGGTGAGCTCGGGTTTC
TCCGGCGTCATTAGGCTCCTGGACTGGTTCGAGAGGCCCGACAGTTTCGTCCTGATCCTG
GAGAGGCCCGAGCCGGTGCAAGATCTCTTCGACTTCATCACGGAAAGGGGAGCCCTGCAA
GAGGAGCTGGCCCGCAGCTTCTTCTGGCAGGTGCTGGAGGCCGTGCGGCACTGCCACAAC
TGCGGGGTGCTCCACCGCGACATCAAGGACGAAAACATCCTTATCGACCTCAATCGCGGC
GAGCTCAAGCTCATCGACTTCGGGTCGGGGGCGCTGCTCAAGGACACCGTCTACACGGAC
TTCGATGGGACCCGAGTGTATAGCCCTCCAGAGTGGATCCGCTACCATCGCTACCATGGC
AGGTCGGCGGCAGTCTGGTCCCTGGGGATCCTGCTGTATGATATGGTGTGTGGAGATATT
CCTTTCGAGCATGACGAAGAGATCATCAGGGGCCAGGTTTTCTTCAGGCAGAGGGTCTCT
TCAGAATGTCAGCATCTCATTAGATGGTGCTTGGCCCTGAGACCATCAGATAGGCCAACC
TTCGAAGAAATCCAGAACCATCCATGGATGCAAGATGTTCTCCTGCCCCAGGAAACTGCT
GAGATCCACCTCCACAGCCTGTCGCCGGGGCCCAGCAAATAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002648 unedited
ATCCATCTCCCACCAGCGGCGGCGGGACCGGCAGCAGCAGCAGCAGCAGCAGCAGCATCC
ACTAGCCTCCTGCCCCGCGGCGCTGCCGCACGAGCCCCACGAGCCGCTCACCCCGCCGTT
CTCAGCGCTGCCCGACCCCGCTGGCGCGCCCTCCCGCCGCCAGTCCCGGCAGCGCCCCTG
CCGTCCTCCGACTCGCCCTCGGCCTTCCGCGCCAGCCGCAGCGACAGCCGCAACGCCACC
CGCAGCCACAGCCACAGCCACAGCCCCAGGCATAGCCTTCGGCACAGCCCCGGCTCCGGC
TCCTGCGGCAGCTCCTCTGGGCACCGTCCCTGCGCCGACATCCTGGAGGTTGGGATGCTC
TTGTCCAAAATCAACTCGCTTGCCCACCTGCGCGCCGCGCCCTGCAACGACCTGCACGCC
ACCAAGCTGGCGCCCGGCAAGGAGAAGGAGCCCCTGGAGTCGCAGTACCAGGTGGGCCCG
CTACTGGGCAGCGGCGGCTTCGGCTCGGTCTACTCAGGCATCCGCGTCTCCGACAACTTG
CCGGTGGCCATCAAACACGTGGAGAAGGACCGGATTTCCGACTGGGGAGAGCTGCCTAAT
GGCACTCGAGTGCCCATGGAAGTGGTCCTGCTGAANAAGTGAGCTCGGGTTTCTCCGGCG
TCATTAGGCTCCTGGACTGGTTCGAGAGGCCCGACAGNTTCGTCCTGATCCTGGAGAGGC
CCGAGCCGGTGCAAGATCTCTTCGACTTCCTCACGGAAAGGGGAGCCCTGCAAGAAGAGC
TGGCCCGCAACTTCTTCTGGCAAGTGCTGGNAGCCGTGCGGTACTGCCCAATT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002648 unedited
TTTTTTTTTTTTTTTTTAAAACAAAGGTTTTTATTCAAAAAACGCCAAGTATAAAAAAAA
AAATAAGATCTCTTTTATTCCCCTGTACAGTATTTCACTCAAATAAAACCAGCAGGCTAC
CTGCTGCTCAAAACACAGCCCCAGAGAGGATCTGGAAGGCACACCATCCAAAACTGCTTT
TCATAATTATCCTATATACACAGTCAGCAATGCCCCTCCCCATCACCCACAGAGCCGGGA
CCCACCTGGGTAAGTAGGTGAGGGGCCCCACAGAAGCCAGGGAGCTGCAGCACTGTCCCG
CCTGAGTCCCGTCACCCCACAAACAGAGCAAGCGTCGCAGCCCTCCCCCAAAAGGTCCCC
AAGTCAGAGGAGGAAAGGAGGAAAGAAAACTAGGGCAGCAGCTATGGAAGCTTGGAATAG
GAAGGGAACCAAATAAATAAATAAATAAATA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002648
ORF Size 942 bp
Insert Size 2560
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002648.2, NP_002639
RefSeq Size 2684
Locus ID 5292
Cytogenetics 6p21.2
Domains pkinase, TyrKc, S_TKc
Protein Families Protein Kinase, ES Cell Differentiation/IPS, Druggable Genome
Protein Pathways Jak-STAT signaling pathway, Acute myeloid leukemia
Gene Summary The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and PIM subfamily. This gene is expressed primarily in B-lymphoid and myeloid cell lines, and is overexpressed in hematopoietic malignancies and in prostate cancer. It plays a role in signal transduction in blood cells, contributing to both cell proliferation and survival, and thus provides a selective advantage in tumorigenesis. Both the human and orthologous mouse genes have been reported to encode two isoforms (with preferential cellular localization) resulting from the use of alternative in-frame translation initiation codons, the upstream non-AUG (CUG) and downstream AUG codons (PMIDs:16186805, 1825810).[provided by RefSeq, Aug 2011].
Transcript Variant: This variant (1) encodes two isoforms resulting from the use of alternate in-frame, translation initiation codons. This RefSeq represents the shorter isoform (2, also known as Pim-1S) derived from the use of a downstream AUG (at nt 431-433). Pim-1S has been shown to localize predominantly in the nucleus (PMID:16186805).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations