HSPA1L (NM_005527) Human Untagged Clone

CAT#: SC110926

HSPA1L (untagged)-Human heat shock 70kDa protein 1-like (HSPA1L)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HSPA1L (NM_005527) Human Untagged Clone
Symbol HSPA1L
Synonyms HSP70-1L; HSP70-HOM; HSP70T; hum70t
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC110926 sequence for NM_005527 edited (data generated by NextGen Sequencing)
ATGGCTACTGCCAAGGGAATCGCCATAGGCATCGACCTGGGCACCACCTACTCCTGTGTG
GGGGTGTTCCAGCACGGCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACC
CCCAGCTACGTGGCCTTCACAGACACCGAGCGGCTCATTGGGGATGCGGCCAAGAACCAG
GTAGCAATGAATCCCCAGAACACTGTTTTTGATGCTAAACGTCTGATCGGCAGGAAATTT
AATGATCCTGTTGTACAAGCAGATATGAAACTTTGGCCTTTTCAAGTGATTAATGAAGGA
GGCAAGCCCAAAGTCCTTGTGTCCTACAAAGGGGAGAATAAAGCTTTCTACCCTGAGGAA
ATCTCTTCGATGGTATTGACTAAGTTGAAGGAGACTGCTGAGGCCTTTTTGGGCCACCCT
GTCACCAATGCAGTGATTACCGTGCCAGCCTATTTCAATGACTCTCAACGTCAGGCTACT
AAGGATGCAGGTGTGATTGCTGGACTTAATGTGCTAAGAATCATCAATGAGCCCACGGCT
GCTGCCATTGCCTATGGTTTAGATAAAGGAGGTCAAGGAGAACGACATGTCCTGATTTTT
GATCTGGGTGGAGGCACATTTGATGTGTCAATTCTGACCATAGATGATGGGATTTTTGAG
GTAAAGGCCACTGCTGGGGACACTCACCTGGGTGGGGAGGACTTTGACAACAGGCTTGTG
AGCCACTTCGTGGAGGAGTTCAAGAGGAAACACAAAAAGGACATCAGCCAGAACAAGCGA
GCCGTGAGGCGGCTGCGCACCGCCTGCGAGAGGGCCAAGAGGACCCTGTCGTCCAGCACC
CAGGCCAACCTAGAAATTGATTCACTTTATGAAGGCATTGACTTCTATACATCCATCACC
AGAGCTCGATTTGAAGAGTTGTGTGCAGACCTGTTTAGGGGTACCCTGGAGCCTGTAGAA
AAAGCGCTTCGGGATGCCAAGATGGATAAGGCTAAAATCCATGACATTGTTTTAGTAGGG
GGCTCCACCCGCATCCCCAAGGTGCAGCGGCTGCTTCAGGACTACTTCAATGGACGTGAT
CTCAACAAGAGCATCAACCCTGATGAGGCCGTAGCATATGGGGCTGCGGTACAAGCAGCC
ATCCTGATGGGGGACAAGTCTGAGAAGGTACAGGACCTGCTGCTGCTGGACGTGGCTCCC
CTGTCCCTGGGGCTGGAGACGGCTGGGGGCGTGATGACTGCCCTGATAAAGCGCAACTCC
ACCATCCCCACCAAGCAGACACAGATTTTCACCACCTACTCTGACAACCAACCCGGGGTG
CTGATCCAGGTGTATGAGGGCGAGAGGGCCATGACAAAGGACAACAACCTGCTGGGGCGG
TTTGACCTGACTGGAATCCCTCCAGCACCCAGGGGAGTTCCTCAGATCGAGGTGACGTTT
GACATTGATGCCAATGGTATTCTCAATGTCACAGCCATGGACAAGAGCACCGGCAAGGTG
AACAAGATCACCATCACCAATGACAAGGGCCGCCTGAGCAAGGAGGAGATTGAGCGCATG
GTTCTGGATGCTGAGAAATATAAAGCTGAAGATGAGGTCCAGAGGGAGAAAATTGCTGCA
AAGAATGCCTTAGAATCCTATGCTTTTAACATGAAGAGTGTTGTGAGTGATGAAGGTTTG
AAGGGCAAGATTAGTGAGTCTGATAAAAATAAAATATTGGATAAATGCAACGAGCTCCTT
TCGTGGCTGGAGGTCAATCAACTGGCAGAGAAAGATGAGTTTGATCATAAGAGAAAGGAA
TTGGAGCAGATGTGTAACCCTATCATCACAAAACTCTACCAAGGAGGATGCACTGGGCCT
GCCTGCGGAACAGGGTATGTGCCTGGAAGGCCTGCCACAGGCCCCACAATTGAAGAAGTA
GATTAA

Clone variation with respect to NM_005527.3
1478 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005527 unedited
TGATTTTGTATCCGACTTACTTATAGGGCGGCCGCGAATTCGCACGAGGCTTTTAATTGT
GGGGGCTTGCTGGGCCTGCGCAGTTGTGGGCAGGGGGCTGGTGCGGGGAGCGGGTTACGC
GCGTCCATGGGAGGGTGGGGGCGTTTGTGTTGACACCGCCCGGCCACGTTACAATGGAGA
TACTGTCTCTGACCTCATGGGCCAGTTTGGAAAAAGATTACTGAGTTGGAGCCGTCTCAA
ATTTGCAGGGAGGGACGGGGTGGGGGGTGGGGGGACCCCGGTTGTGCAGTTTGATATTGA
GGGAGCCCCCACCTACTCGCTGGGGCTGCGTAATCTGGACGTTTCCAAACTGAAGCGAAG
GCGTCGGGAGACTAGGCCTCAGAGAACCATGGCTACTGCCAAGGGAATCGCCATAGGCAT
CGACCTGGGCACCACCTACTCCTGTGTGGGNGGTGTTCCAGCACGGCAAGGTGGAGATCA
TCGCCAACGACCAGGGCAACCGCACCACCCCCAGCTACGTGGCCTTCACAGACACCGAGC
GGCTCATTGGGGATGCGGCCAAGAACCAGGTAGCAATGAATCCCCAGAACACTGTTTTTG
ATGCTAAACGTCTGATCGGCAGGAAATTTAATGATCCTGTTGTACAAGCAGATATGAAAC
TTTGGCCTTTTCAAGTGATTAATGACAGAGGCAAGCCCAAAGTCCTTGTGTCCTACAAAG
GGGAGAATAAAGCTTTCTACCCTGAGGAAATCTCTTCGATGGTATTGACTAAGTTGAAAG
AGACTGCTGAGGCCTTTTTGGGCCACCCTGTTCCCAATGCAGTGATTACCGTGCCACCCT
ATTTAATGACTCTCAACGTCAGCTATTAAGGATGACGGTGTGAATTGCTGTACTC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005527 unedited
NGGGCNNCCCCNNNNNNNNTTTTNNNNNNNNNATTGACTTTGNACCNCGGNCCGCATNCT
ANGATCGAGTTTTTTTTTTTTTTTTTTCTTTACGAACAAATTTACTGATTGACAAATAAG
CATCCACACCAGGAAGAAGAATGTTAGGGTGGCTTGGAAATAACAGACATTCAAATACAT
CACACGGTTTAAAGAGGGGCCTAGTTTTCCTGAGTCCATTCCAAAGTCAAAAACAGGATG
TGAGGGAGTGTGATAGGTGGTGCATGAGACTCCTTCTCCAGAATTTCCAAGGGATGGTAA
CTTAGATTCAGGTCTGGTCAAGAATAATAATGATGTTTGAAGATGAGGGGAATGAAATAC
ATGTAGAGGCATCCTAGGATGCTTCAGTTCTAAAAAGAATTAATCTACTTCTTCAATTGT
GGGGCCTGTGGCAGGCCTTCCAGGCACATACCCTGTTCCGCAGGCAGGCCCAGTGCATCC
TCCTTGGTAGAGTTTTGTGATGATAGGGTTACACATCTGCTCCAATTCCTTTCTCTTATG
ATCAAACTCATCTTTCTCTGCCAGTTGATTGACCTCCAGCCACGAAAGGAGCTCGTTGCA
TTTATCCAATATTTTATTTTTATCAGACTCACTAATCTTGCCCTTCAAACTTCATCACTC
ACAACACTCTTNCATGTAAAAGCATAGGGATTCTAAGGCATTNCTTGCAGNCATTTTCTC
CCTCTGGACCTCATCTTCAGCTTTATATTTCTAGCATCCAGAACATGCGCTCAATCTCCT
CCTTGCTCAGGCGGCCTTGNCATTGGTGATGGNGATCTTGTCACCTTGCCCGGGCTCTTG
TCATGGCTGTGACATGAAATACCATGGCATCATGTCAACGTCACCTCGATCTGAGAACTC
CCTGGGGGCTGGAGGGATTCAGTCAGGTCAACCGCCCCACGGTTGGTGGCCTTTGTATGG
GCCTTTCGCCTAATAACTGAATAACACCCCGGGTGGTTGCAAAAAGGGGGAAAAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005527
ORF Size 1926 bp
Insert Size 2620
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005527.2, NP_005518
RefSeq Size 2509
RefSeq ORF 1926
Locus ID 3305
Cytogenetics 6p21.33
Domains HSP70
Protein Pathways Spliceosome, MAPK signaling pathway, Endocytosis, Antigen processing and presentation
Gene Summary This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.