FKBP12 (FKBP1A) (NM_054014) Human Untagged Clone

SKU
SC110896
FKBP1A (untagged)-Human FK506 binding protein 1A, 12kDa (FKBP1A), transcript variant 2
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FKBP12
Synonyms FKBP-1A; FKBP-12; FKBP1; FKBP12; PKC12; PKCI2; PPIASE
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC110896 sequence for NM_054014 edited (data generated by NextGen Sequencing)
ATGGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGC
CAGACCTGCGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCC
CGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGG
GAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGAT
TATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTC
GATGTGGAGCTTCTAAAACTGGAATGA

Clone variation with respect to NM_054014.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_054014 unedited
NGGTTCGGGATTTTGTNATACGACTTACTATAGGGCGGCCGCGAATTCGCACCAGCCGAG
GTACTAGGCAGAGCCGTGGAACCGCCGGCAGGTCGCTGTTGGTCCACGCCGCCCGTCGCG
CCGCCCGCCCGCTCAGCGTCCGCCGCCGCCATGGGAGTGCAGGTGGAAACCATCTCCCCA
GGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGACCTGCGTGGTGCACTACACCGGGATG
CTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATG
CTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGT
CAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGC
ATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGACAG
GAATGGCCTCCTCCCTTAGCTCCCTGTTCTTGGGTAAGGAAATGGAATACTGAAGGGCCC
TTCACTGCCTTTGCTCCTCCCATGTTATGCCCAGCGTTTGATGGGTAGCAGAGAGAACAA
AAAACACCACAAGGCTATTTTTCCCCCTGCATTCTTTCTGTATTGAGTATCCTTTCAGTG
TTATTAGTGTATGCTTTGAATGTAAAAATTGGTCACCCTAAGGAAAGGAATTGGCATGTG
TATGTTCCCAGTTCAACTCATGGAGATGGCAGCTGTTTAAATGTTTTTCTATGTAGTTTA
TAAATTAAAACTGAATTGAGGACTATGGNAATGTANGCCAAATTTGTAGTGCCAACATTN
TAGNNTCTTTGGAAATAAGACTCTTAATGAATGACTNTGNTCTACCCTGTNGTTCTAGAA
GCTAGAGGGGGGAAAAAAAGCCCCTTGGATATGATACATGTCCTAGCTCTGCGGC
Restriction Sites NotI-NotI
ACCN NM_054014
Insert Size 3750 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_054014.1, NP_463460.1
RefSeq Size 810 bp
RefSeq ORF 327 bp
Locus ID 2280
UniProt ID P62942
Cytogenetics 20p13
Domains FKBP
Protein Families Druggable Genome
Summary The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium. Multiple alternatively spliced variants, encoding the same protein, have been identified. The human genome contains five pseudogenes related to this gene, at least one of which is transcribed. [provided by RefSeq, Sep 2008]
Transcript Variant: This variant (2, also known as 12A) differs in the 3' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (a).
Write Your Own Review
You're reviewing:FKBP12 (FKBP1A) (NM_054014) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200662 FKBP1A (Myc-DDK-tagged)-Human FK506 binding protein 1A, 12kDa (FKBP1A), transcript variant 2 10 ug
$150.00
RC200662L3 Lenti ORF clone of Human FK506 binding protein 1A, 12kDa (FKBP1A), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC200662L4 Lenti ORF clone of Human FK506 binding protein 1A, 12kDa (FKBP1A), transcript variant 2, mGFP tagged 10 ug
$450.00
RG200662 FKBP1A (tGFP-tagged) - Human FK506 binding protein 1A, 12kDa (FKBP1A), transcript variant 2 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.