HSD3B7 (NM_025193) Human Untagged Clone

CAT#: SC110313

Reviews ()
Write a review

HSD3B7 (untagged)-Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 (HSD3B7), transcript variant 1



  "NM_025193" in other vectors (6)

Reconstitution Protocol

USD 457.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "HSD3B7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HSD3B7
Synonyms CBAS1; PFIC4; SDR11E3
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC110313 sequence for NM_025193 edited (data generated by NextGen Sequencing)
ATGGCCGACTCTGCACAGGCCCAGAAGCTGGTGTACCTGGTCACAGGGGGCTGTGGCTTC
CTGGGAGAGCACGTGGTGCGAATGCTGCTGCAGCGGGAGCCCCGGCTCGGGGAGCTGCGG
GTCTTTGACCAACACCTGGGTCCCTGGCTGGAGGAGCTGAAGACAGGGCCTGTGAGGGTG
ACTGCCATCCAGGGGGACGTGACCCAGGCCCATGAGGTGGCAGCAGCTGTGGCCGGAGCC
CATGTGGTCATCCACACGGCTGGGCTGGTAGACGTGTTTGGCAGGGCCAGTCCCAAGACC
ATCCATGAGGTCAACGTGCAGGGTACCCGGAACGTGATCGAGGCTTGTGTGCAGACCGGA
ACACGGTTCCTGGTCTACACCAGCAGCATGGAAGTTGTGGGGCCTAACACCAAAGGTCAC
CCCTTCTACAGGGGCAACGAAGACACCCCATACGAAGCAGTGCACAGGCACCCCTATCCT
TGCAGCAAGGCCCTGGCCGAGTGGCTGGTCCTGGAGGCCAACGGGAGGAAGGTCCGTGGG
GGGCTGCCCCTGGTGACGTGTGCCCTTCGTCCCACGGGCATCTACGGTGAAGGCCACCAG
ATCATGAGGGACTTCTACCGCCAGGGCCTGCGCCTGGGAGGTTGGCTCTTCCGGGCCATC
CCGGCCTCTGTGGAGCATGGCCGGGTCTATGTGGGCAATGTTGCCTGGATGCACGTGCTG
GCAGCCCGGGAGCTGGAGCAGCGGGCAGCCCTGATGGGCGGCCAGGTATACTTCTGCTAC
GATGGATCACCCTACAGGAGCTACGAGGATTTCAACATGGAGTTCCTGGGCCCCTGCGGA
CTGCGGCTGGTGGGCGCCCGCCCATTGCTGCCCTACTGGCTGCTGGTGTTCCTGGCTGCC
CTCAATGCCCTGCTGCAGTGGCTGCTGCGGCCACTGGTGCTCTACGCACCCCTGCTGAAC
CCCTACACGCTGGCCGTGGCCAACACCACCTTCACCGTCAGCACCGACAAGGCTCAGCGC
CATTTCGGCTATGAGCCCCTGTTCTCGTGGGAGGATAGCCGGACCCGCACCATTCTCTGG
GTACAGGCCGCTACGGGTTCAGCCCAGTGA

Clone variation with respect to NM_025193.3
748 a=>g;1068 t=>c
>OriGene 5' read for NM_025193 unedited
ATTATGTATACGACTCACTATAGGGCGGCNCGCGAATCGGCACCAGGAGGCCCCTCCAGG
CCAGTCTGGGCACCCTGGGATAGCGGCTGCAGCCATCAGCAGGGGCAGACGGCAGGTGGC
CTGGTTGCTGCAGCTCCCAGGATCAGCTCTGCCCTCCCGCCAAACGCCAGCCTCGTCACC
GCTCCAGGGCACCTCCAGCAGTAACAGGTGGTTGCAGCAGGTGGCAGCCAGCCCCTGGAT
GAGCCAAGGTCTCTTCCCCAGCCAGGCATGGCCGACTCTGCACAGGCCCAGAAGCTGGTG
TACCTGGTCACAGGGGGCTGTGGCTTCCTGGGAGAGCACGTGGTGCGAATGCTGCTGCAG
CGGGAGCCCCGGCTCGGGGAGCTGCGGGTCTTTGACCAACACCTGGGTCCCTGGCTGGAG
GAGCTGAAGACAGGGCCTGTGAGGGTGACTGCCATCCAGGGGGACGTGACCCAGGCCCAT
GAGGTGGCAGCAGCTGTGGCCGGAGCCCATGTGGTCATCCACACGGCTGGGCTGGTAGAC
GTGTTTGGCAGGGCCAGTCCCAAGACCATCCATGAGGTCAACGTGCAGGGTACCCGGAAC
GTGATCGAGGCTTGTGTGCAGACCGGAACACGGTTCCTGGTCTACACCAGCAGCATGGAA
GTTGTGGGGCCTAACACCAAAGGTCACCCCTTCTACAGGGGCAACGAAGACACCCCATAC
GAAGCAGTGCACAGGCACCCCTATCCTTGCAGCAAGGCCCTGGCCGAGTGGCTGGTCCTG
GAGGCCACGGGAGGAAGGTCCGTGGNGGGCTGCCCCTGGTGACGTGTGCCTTTCGTCCCA
CGGCATCTACGGTGAAGGCCACCAGATCATGAGGNACTNCTACCGCCAGGNCCTGCGCCT
GGGAGGNTGGCTCTTCGGNCCATCCNGNCTCTGTGGACATGGCCGGTCTAGTGGGCATGT
GCCTGGAGCACTGCTGCACCCGGAACTG
>OriGene 3' read for NM_025193 unedited
NGGGGGNNNNNNNNNNNNNTTTTNNNNNNANNNNTAATCTNTGNNACGCGGNCCGCATTT
NANGATCGAGNNNTTTTTTTTTTTGTTTTTTTTTTTTTTTTTTTTTTTGGGGATGAAGGT
TTTAAACCGGGGTCAACCAGGTACAACATTGGGGACATCCCCCAGCCCAAGGCTGGCGAT
GTGCTGGGAAGGAACTTAAGTAAAAAGGGGGGAAGTGAAAACATAAGGAGGCCCTAACCC
TCCAAAGGGGAATTTTAAAACAAACAGTTGAAGGGGAGGCCTTTGAAAAACAATGGGAAC
ATCACCTCCCAAAAAGGGACTGAGGGGGCTGGAGGAACCAAAACCGCCTTTGCACTTTGC
ACCGAGGGTCCCGTGTGGCTGTCAAGAAAACAACGTAAGCCTGTGGAGCCTCTGGTCGCT
TTCTGCTCAAAAAGCCAAAAGAAAACTGGGGCAGGCCACCAGGGCACCAAACACTTACCA
AGCGGGCATTANGACTGGGATGAGAGGACAGAGGAAGGACACTCTGTCCCCAAACCCTTC
CGTGTCCTGACGGGCCTAGAACTTGGAGGTGTCAAGACACAACACAGACTCAAGGCTTCT
GGATTGAAAATGTGGGAGGCTTGGGCCAAGCGCGGTGGCTCACACTTGTAGTTCCAACGT
TTTGGGAAGGCCACGTGGGAAGATCACTTGAGCCCAGAGTTCAAGACCAAGCTGAGCATA
TAGTGAGACCCTGTCCTTAAAACAACAAAAAAAAGCCAGTGTGTTGGCGTGCACCTGTGG
CCCNACTGTTCACGAAGCTTAGGCAGGAGATATTCTTAAACCACAGAGGTGTAGGGGGCA
TGACCTATTATTACCCCACTTGCCTCCAGTTTGGGGACCAAGCAGAACCTGTCTCAAAAG
AAAAAGAAATTGAAGGGCTTTANAAAGGAAGNCATTCTGGCCCAGAGCCTGGCTCTGCTC
TGAATGCACTGCCCTTCCGCACAGGGTGAGGGCTCGGCCTCGGGGTATGGCTGATCTGGG
CTCCAGGCAACCC
Restriction Sites NotI-NotI     
ACCN NM_025193
Insert Size 2210 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_025193.2, NP_079469.2
RefSeq Size 2189 bp
RefSeq ORF 1110 bp
Locus ID 80270
UniProt ID Q9H2F3
Cytogenetics 16p11.2
Domains 3Beta_HSD
Protein Families Transmembrane
Protein Pathways Metabolic pathways, Primary bile acid biosynthesis
Gene Summary This gene encodes an enzyme which is involved in the initial stages of the synthesis of bile acids from cholesterol and a member of the short-chain dehydrogenase/reductase superfamily. The encoded protein is a membrane-associated endoplasmic reticulum protein which is active against 7-alpha hydrosylated sterol substrates. Mutations in this gene are associated with a congenital bile acid synthesis defect which leads to neonatal cholestasis, a form of progressive liver disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Transcript Variant: This variant (1) encodes the longer isoform (a).

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.