WISP1 (NM_080838) Human Untagged Clone

CAT#: SC109994

WISP1 (untagged)-Human WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 2

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name WISP1 (NM_080838) Human Untagged Clone
Symbol WISP1
Synonyms CCN4; WISP1c; WISP1i; WISP1tc
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC109994 sequence for NM_080838 edited (data generated by NextGen Sequencing)
ATGAGGTGGTTCCTGCCCTGGACGCTGGCAGCAGTGACAGCAGCAGCCGCCAGCACCGTC
CTGGCCACGGCCCTCTCTCCAGCCCCTACGACCATGGACTTTACCCCAGCTCCACTGGAG
GACACCTCCTCACGCCCCCAATTCTGCAAGTGGCCATGTGAGTGCCCGCCATCCCCACCC
CGCTGCCCGCTGGGGGTCAGCCTCATCACAGATGGCTGTGAGTGCTGTAAGATGTGCGCT
CAGCAGCTTGGGGACAACTGCACGGAGGCTGCCATCTGTGACCCCCACCGGGGCCTCTAC
TGTGACTACAGCGGGGACCGCCCGAGGTACGCAATAGGAGTGTGTGCACATGCTGTGGGT
GAGGTGGAGGCATGGCACAGGAACTGCATAGCCTACACAAGCCCCTGGAGCCCTTGCTCC
ACCAGCTGCGGCCTGGGGGTCTCCACTCGGATCTCCAATGTTAACGCCCAGTGCTGGCCT
GAGCAAGAGAGCCGCCTCTGCAACTTGCGGCCATGCGATGTGGACATCCATACACTCATT
AAGGCAGGGAAGAAGTGTCTGGCTGTGTACCAGCCAGAGGCATCCATGAACTTCACACTT
GCGGGCTGCATCAGCACACGCTCCTATCAACCCAAGTACTGTGGAGTTTGCATGGACAAC
AGGTGCTGCATCCCCTACAAGTCTAAGACTATCGACGTGTCCTTCCAGTGTCCTGATGGG
CTTGGCTTCTCCCGCCAGGTCCTATGGATTAATGCCTGCTTCTGTAACCTGAGCTGTAGG
AATCCCAATGACATCTTTGCTGACTTGGAATCCTACCCTGACTTCTCAGAAATTGCCAAC
TAG

Clone variation with respect to NM_080838.2
660 t=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_080838 unedited
ATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGCCGGCCAGTCT
GGGCCCAGCTCCCCCGAGAGTGGTCGGATCCTCTGGGCTGCTCGGTCGATGCCTGTGCCA
CTGACGTCCAGGCATGAGGTGGTTCCTGCCCTGGACGCTGGCAGCAGTGACAGCAGCAGC
CGCCAGCACCGTCCTGGCCACGGCCCTCTCTCCAGCCCCTACGACCATGGACTTTACCCC
AGCTCCACTGGAGGACACCTCCTCACGCCCCCAATTCTGCAAGTGGCCATGTGAGTGCCC
GCCATCCCCACCCCGCTGCCCGCTGGGGGTCAGCCTCATCACAGATGGCTGTGAGTGCTG
TAAGATGTGCGCTCAGCAGCTTGGGGACAACTGCACGGAGGCTGCCATCTGTGACCCCCA
CCGGGGCCTCTACTGTGACTACAGCGGGGACCGCCCGAGGTACGCAATAGGAGTGTGTGC
ACATGCTGTGGGTGAGGTGGAGGCATGGCACAGGAACTGCATAGCCTACACAAGCCCCTG
GAGCCCTTGCTCCACCAGCTGCGGCCTGGGGGTCTCCACTCGGATCTCCAATGTTAACGC
CCAGTGCTGGCCTGAGCAAGAGAGCCGCCTCTGCAACTTGCGGCCATGCGATGTGGACAT
CCATACACTCATTAAGGCAGGGAAGAAGTGTCTGGCTGTGTACCAGCCAGAGGCATCCAT
GAAACTCACACTTGCGGGCTGCATCAGCACACGCTCCTATCAACCCAGTACTGTGGAGTT
TGCATGGACCACAAGTGCTGCATCCCCTACAAGTCTAAGACTATCGACGTGTCCTTCCAA
TGGTCTGATGGGCGTGGCTTCTCCCGCCAAGCCTATGGATTATGACTGCTTCTGTACCTG
AGCTGTAGGAATCCAAGACATCTTGCTGACTTGGAATCTACCTGACTCTCCGAAATGCAA
CTAAGCAGCCAAACTTGGTCTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_080838 unedited
ATGGCCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGACATTAAAAAATA
AGCCATTTATTGCAATGTTTTCCTATTCTGACACATTTGGAAGCTCTAAAAACAGGGGGA
AAATATGGGTTATAAAGACAGTCCAATTTCGATCTGAATCCTAACTTTCCCAGTCACCAA
CTGGGTGACTCTGGTTGAGTTTTCTCACCTCTATGAGCTTCCGTTTCACATTTGTAAGAA
CAGAAATAATAATGGGAACTTCTCAACATTGTCGTGAAGATTCAGTGAGCTAATACATGC
AAAGCACTGAGAGCAATGTCTGGCACAGAAAAGGCCCTAAATAAAAGAATTCTAACAGTA
AATATTATATTTTCCTAATACAATAAATAATAGCCTGATATTCATTAACAACAACCTTTT
CCTTTTAGCTTCAACCTCTTCAGCTTTAAACCTTTATTAAGTCTATTTCTGTTTCTAAAC
AACCGGTAAACCTCCATCTTCCTACCAGAAAACTGGCCATTTGGTCAGCAGAACGAAAGG
CTGTGAAATGAGTCTCTGCAATAGATGTGTCCTGAACACGGGGGCCCCTGGAGTCCCACA
GCCTCCAGCTCTAGAGGTCACCCCAGGCTGCTACCAAGGGCACCCACTTCTTGGTTTGAC
CCACACCCCTACCTGAACCTGTCTTGGTCATTTCAGTAGGTCTGGCATGGTCTGCAGCTG
GGTCTCTCAAGGCTCTGTAAGAGTAGAGGAGTGTTCCAGGGCACCACTCTCAGGGGCCAG
ACAGGCCAGTCCCAGAGCCTTACCAATTCCTATGACCCCCAAGCAGACAAGGGAGGAGAT
TCAAGAAAGAGCCTGGGCAACTTGCCAAAGCCCTGCCAGTCAACAGCTGATTCAGTGTGA
GAGCCAATGGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_080838
ORF Size 843 bp
Insert Size 2660
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_080838.1, NP_543028
RefSeq Size 1035
RefSeq ORF 843
Locus ID 8840
Cytogenetics 8q24.22
Protein Families Stem cell relevant signaling - DSL/Notch pathway, Stem cell relevant signaling - Wnt Signaling pathway, Secreted Protein, ES Cell Differentiation/IPS, Adult stem cells, Embryonic stem cells, Druggable Genome
Gene Summary This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011].
Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, as compared to variant 1. Isoform 2 encoded by this variant thus lacks a von Willbrand type C module that is thought to participate in protein complex formation. This variant is overexpressed in scirrhous carcinomas.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.