RFXANK (NM_134440) Human Untagged Clone

CAT#: SC109969

RFXANK (untagged)-Human regulatory factor X-associated ankyrin-containing protein (RFXANK), transcript variant 2

USD 402


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name RFXANK (NM_134440) Human Untagged Clone
Symbol RFXANK
Synonyms ANKRA1; BLS; F14150_1; RFX-B
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_134440, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTTACCCAGCCTGCAGAAGACCTCATCCAGACCCAGCAGACCCCTGCCTCAGAACTTGGGGACC
CTGAAGACCCCGGAGAGGAGGCTGCAGATGGCTCAGACACTGTGGTCCTCAGTCTCTTTCCCTGCACCCC
TGAGCCTGTGAATCCTGAACCGGATGCCAGTGTTTCCTCTCCACAGGGCAGCTCCCTGAAGCACTCCACC
ACTCTCACCAACCGGCAGCGAGGGAACGAGGTGTCAGCTCTGCCGGCCACCCTAGACTGTGACAACCTCG
TCAACAAGCCAGACGAGCGCGGCTTCACCCCCCTCATCTGGGCCTCCGCCTTTGGAGAGATTGAGACCGT
TCGCTTCCTGCTGGAGTGGGGTGCCGACCCCCACATCCTGGCAAAAGAGCGAGAGAGCGCCCTGTCGCTG
GCCAGCACAGGCGGCTACACAGACATTGTGGGGCTGCTGCTGGAGCGTGACGTGGACATCAACATCTATG
ATTGGAATGGAGGGACGCCACTGCTGTACGCTGTGCGCGGGAACCACGTGAAATGCGTTGAGGCCTTGCT
GGCCCGAGGCGCTGACCTCACCACCGAAGCCGACTCTGGCTACACCCCGATGGACCTTGCCGTGGCCCTG
GGATACCGGAAAGTGCAACAGGTGATCGAGAACCACATCCTCAAGCTCTTCCAGAGCAACCTGGTGCCCG
CTGACCCTGAGTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_134440 unedited
AACACCCGCCCGTTGNCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCA
GAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGA
ATTCGGCACGAGGGAGGAAGCCAGATCGCTGAGGGTCCGGTCTCCAGTTTGCCTCCTGCT
ATATCCATTGGAAGAGAAAAGTTTGTGACTTGGGCCCCCAAGTTTTGAGAGAACTGGGCT
TTCGGCGCGGGGGGACAGAGGAGGCTCGTGGGGAGCTTTCCCCATGGAGCTTACCCAGCC
TGCAGAAGACCTCATCCAGACCCAGCAGACCCCTGCCTCAGAACTTGGGGACCCTGAAGA
CCCCGGAGAGGAGGCTGCAGATGGCTCAGACACTGTGGTCCTCAGTCTCTTTCCCTGCAC
CCCTGAGCCTGTGAATCCTGAACCGGATGCCAGTGTTTCCTCTCCACAGGGCAGCTCCCT
GAAGCACTCCACCACTCTCACCAACCGGCAGCGAGGGAACGAGGTGTCAGCTCTGCCGGC
CACCCTAGACTCCCTGTCCATCCACCAGCTCGCAGCACAGGGGGAGCTGGACCAGCTGAN
AGAGCATTTGCGGAAAGGTGACAACCTCGTCAACAAGCCAGACGAGCGCGGCTTCACCCC
CCTCATCTGGGCCTCGGCCTTTGGAGAGATTGAGACCGTTCGCTTCTGCTGAATTGGGGG
TGCCGACCCCACCATCCTGGCAAAGAGCGAAGAGACGCCCTGTCCGCTGGCAACCAAGGG
CGCTACCCAGACTTGGGGGGCTGCTGCTGGAACCTGACTTGGCACTCACCTCTTGATTGA
AAGGAGGGCCCCCCTGGTGTACCCTGGGCCCGGAACCCCTGAAAAGCTTGAGGCCTTGTG
GCCCGGGCCTTGACCTCCCCCCGAGCCGATTGGGGTAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_134440
ORF Size 714 bp
Insert Size 1400
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_134440.1, NP_604389
RefSeq Size 1369
RefSeq ORF 714
Locus ID 8625
Cytogenetics 19p13.11
Domains ank
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Antigen processing and presentation, Primary immunodeficiency
Gene Summary Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) has an alternate splice site and lacks an in-frame exon in the coding region, as compared to transcript variant 1. The resulting isoform (b) lacks an internal single aa and an internal segment, as compared to isoform a. Variants 2 and 4 encode the same isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.