Kv beta 1 (KCNAB1) (NM_172159) Human Untagged Clone

CAT#: SC109907

Reviews ()
Write a review

KCNAB1 (untagged)-Human potassium voltage-gated channel, shaker-related subfamily, beta member 1 (KCNAB1), transcript variant 3

  View "NM_172159" in other vectors (10)

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Kv beta 1 (KCNAB1) (NM_172159) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol KCNAB1
Synonyms AKR6A3; hKvb3; hKvBeta3; KCNA1B; KV-BETA-1; Kvb1.3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC109907 sequence for NM_172159 edited (data generated by NextGen Sequencing)
ATGCAAGTCTCCATAGCCTGCACAGAGCACAATTTGAAGAGTCGGAATGGTGAGGACCGA
CTTCTGAGCAAGCAGAGCTCCACCGCCCCCAATGTGGTGAACGCAGCCCGGGCCAAATTC
CGCACGGTCGCTATCATCGCGCGCAGCCTGGGGACGTTCACGCCTCAGCATCACATTTCT
CTCAAAGAGTCCACCGCAAAGCAGACTGGCATGAAATATAGGAATCTTGGAAAATCAGGA
CTCAGAGTTTCTTGCTTGGGTCTTGGAACATGGGTGACATTTGGAGGTCAAATTTCAGAT
GAGGTTGCTGAACGGCTGATGACCATCGCCTATGAAAGTGGTGTTAACCTCTTTGATACT
GCCGAAGTCTATGCTGCTGGAAAGGCTGAAGTGATTCTGGGGAGCATCATCAAGAAGAAA
GGCTGGAGGAGGTCCAGTCTGGTCATAACAACCAAACTCTACTGGGGTGGAAAAGCTGAA
ACAGAAAGAGGGCTGTCAAGAAAGCATATTATTGAAGGATTGAAGGGCTCCCTCCAGAGG
CTGCAGCTCGAGTATGTGGATGTGGTCTTTGCAAATCGACCGGACAGTAACACTCCCATG
GAAGAAATTGTCCGAGCCATGACACATGTGATAAACCAAGGCATGGCGATGTACTGGGGC
ACCTCGAGATGGAGTGCTATGGAGATCATGGAAGCCTATTCTGTAGCAAGACAGTTCAAT
ATGATCCCACCGGTCTGTGAACAAGCTGAGTACCATCTTTTCCAGAGAGAGAAAGTGGAG
GTCCAGCTGCCAGAGCTCTACCACAAAATAGGTGTTGGCGCAATGACATGGTCTCCACTT
GCCTGTGGAATCATCTCAGGAAAATACGGAAACGGGGTGCCTGAAAGTTCCAGGGCTTCA
CTGAAGTGCTACCAGTGGTTGAAAGAAAGAATTGTAAGTGAAGAAGGGAGAAAACAGCAA
AACAAGCTAAAAGACCTTTCCCCAATTGCGGAGCGTCTGGGATGCACACTACCTCAGCTA
GCTGTTGCGTGGTGCCTGAGAAATGAAGGTGTGAGTTCTGTGCTCCTGGGATCATCCACT
CCTGAACAACTCATTGAAAACCTTGGTGCCATTCAGGTTCTCCCAAAGATGACATCACAT
GTGGTAAATGAGATTGATAACATACTGCGCAACAAGCCCTACAGCAAGAAGGACTATAGA
TCATAA

Clone variation with respect to NM_172159.3
>OriGene 5' read for NM_172159 unedited
GATTTTGTAATCCGACTTACTATAGGGCGGCCGCGAATTCGGCACGAGGGGAGCAAGGAG
GGCTTAAAAGAAAAGCGGAAATCCCCGCAACTGCTCAACCTCTCGTGACTGCCTGTGTTC
TGGGGTTCTGAGAGGGACCGTGCGCTGCCTGGGGAAGCAATGCAAGTCTCCATAGCCTGC
ACAGAGCACAATTTGAAGAGTCGGAATGGTGAGGACCGACTTCTGAGCAAGCAGAGCTCC
ACCGCCCCCAATGTGGTGAACGCAGCCCGGGCCAAATTCCGCACGGTCGCTATCATCGCG
CGCAGCCTGGGGACGTTCACGCCTCAGCATCACATTTCTCTCAAAGAGTCCACCGCAAAG
CAGACTGGCATGAAATATAGGAATCTTGGAAAATCAGGACTCAGAGTTTCTTGCTTGGGT
CTTGGAACATGGGTGACATTTGGAGGTCAAATTTCAGATGAGGTTGCTGAACGGCTGATG
ACCATCGCCTATGAAAGTGGTGTTAACCTCTTTGATACTGCCGAAGTCTATGCTGCTGGA
AAGGCTGAAGTGATTCTGGGGAGCATCATCAAGAAGAAAGGCTGGAGGAGGTCCAGTCTG
GTCATAACAACCAAACTCTACTGGGGTGGAAAAGCTGAAACAGACAGAGGGCTGTCAAGA
AAGCATATTATTGAAGGATTGAAGGGCTCCCTTCCAGAGCTGCAGCTCGAGTATGTGGAT
GTGGTCTGTGCAAATCGACCTGACAGTAACACTCCCATGGAAGAAATGTCCGAGCCATGA
CACATGTGATAAACCTAAGCATGGCGATGTACTGAGGCACCCTCAGATGCAGTGCTATGG
AGATCATGGCAGCCTATTCTGTAGCAGACAGCTCATATGATCCCACGGTCTGTGAACAGC
TGAGTACATCTTTTCANAAGAGAAGAGGAGTCCAGCTGCCAGACTCTACACAACTAGTGT
NGGCGCATGACTGTNCTCACTGCTGTGGACATCTCAGAAATCG
>OriGene 3' read for NM_172159 unedited
TTGTTACATTATGNACGCGGCCGCATTCTANGATCGAGTTTTTTTTTTTTTTTTTTAAAA
TTGAATGCACAAAATGCTTTTATTACTCTAAGCAAAATAAATCAATCAAATCACATTTCC
CATTAGACAGCACCTCAGCTCCTCTATACATACAGCAGTTCGCTGGATTGAATACACAAT
GAACAACTGAAAATGATCAATTTCCATCATTCTGATAACACGGGCAAAAAATTCAAACTC
TCTGTTAGAATACAGGTACTAGTAATCAAAAAGAAAATTTCTTGATATCTCCCACTAGCA
TTTTCAGATTTAGAATTTAACCATGAAGTACATATCTAGAACTAATGACAGAAAATCGCA
TTTTAAAATAATATTACAGTTCTTCTGTAAACCTCAGAGTGATTTCTGTGTGGGGAACTT
GCTGACCAGAAAATTAAATGAGAATTTTGTACATCCTCAGATAGCCAAATAGAGTTAAAG
GGCCACTCCCACACCACCCCCTTCAAAAAAAAAAAAACATGTTTTCTCTCTTTTTACAGA
TATTGACACAGTATAGTCTCACAATTTTTCTCAAGTGGGATATTAATGAGGGTAAGTAGC
CAATAGTGGCAGGGCTAGATACACCTCAGATTTCGAGTGCAACAAGGGTAAGCCCCATTA
ATCCATGCAAAGAACTTTCATGCATATAGTTTAGTGCATATAATATGATTATAGAACCAG
AAGTTCTTTCTTTAACATTTTGCTTTTCACTAGGCAAGTTAATTTACCCAGCATATTCTG
AATAGTGACATAGCATTTTTCACAAAGCCAGTGGTTGACTTTCATGTTAACAATGCCCTC
AAAATACCAAACATTATATTATAAAATCCCAGTGCTAATTAAACATGAACATTTGCCTTC
C
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_172159
ORF Size 1206 bp
Insert Size 3200
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_172159.2, NP_751891.1
RefSeq Size 4094
RefSeq ORF 1206
Locus ID 7881
Cytogenetics 3q25.31
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (3) has an alternate 5' sequence including the 5' UTR and the 5' coding region, as compared to variant 1. It encodes isoform 3, also known as kvb1.3, which has a shorter and distinct N-terminus than isoform 1.

Other Versions

Other products for "KCNAB1"
Frequently bought together (2)
KCNAB1 (Kv beta 1) mouse monoclonal antibody, clone OTI2F1 (formerly 2F1)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones