TAP2 (NM_000544) Human Untagged Clone

CAT#: SC109816

TAP2 (untagged)-Human transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) (TAP2), transcript variant 1

USD 1,350.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TAP2 (NM_000544) Human Untagged Clone
Symbol TAP2
Synonyms ABC18; ABCB3; APT2; D6S217E; PSF-2; PSF2; RING11
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_000544, the custom clone sequence may differ by one or more nucleotides


ATGCGGCTCCCTGACCTGAGACCCTGGACCTCCCTGCTGCTGGTGGACGCGGCTTTACTGTGGCTGCTTC
AGGGCCCTCTGGGGACTTTGCTTCCTCAAGGGCTGCCAGGACTATGGCTGGAGGGGACCCTGCGGCTGGG
AGGGCTGTGGGGGCTGCTAAAGCTAAGAGGGCTGCTGGGATTTGTGGGGACACTGCTGCTCCCGCTCTGT
CTGGCCACCCCCCTGACTGTCTCCCTGAGAGCCCTGGTCGCGGGGGCCTCACGTGCTCCCCCAGCCAGAG
TCGCTTCAGCCCCTTGGAGCTGGCTGCTGGTGGGGTACGGGGCTGCGGGGCTCAGCTGGTCACTGTGGGC
TGTTCTGAGCCCTCCTGGAGCCCAGGAGAAGGAGCAGGACCAGGTGAACAACAAAGTCTTGATGTGGAGG
CTGCTGAAGCTCTCCAGGCCGGACCTGCCTCTCCTCGTTGCCGCCTTCTTCTTCCTTGTCCTTGCTGTTT
TGGGTGAGACATTAATCCCTCACTATTCTGGTCGTGTGATTGACATCCTGGGAGGTGATTTTGACCCCCA
TGCCTTTGCCAGTGCCATCTTCTTCATGTGCCTCTTCTCCTTTGGCAGCTCACTGTCTGCAGGCTGCCGA
GGAGGCTGCTTCACCTACACCATGTCTCGAATCAACTTGCGGATCCGGGAGCAGCTTTTCTCCTCCCTGC
TGCGCCAGGACCTCGGTTTCTTCCAGGAGACTAAGACAGGGGAGCTGAACTCACGGCTGAGCTCGGATAC
CACCCTGATGAGTAACTGGCTTCCTTTAAATGCCAATGTGCTCTTGCGAAGCCTGGTGAAAGTGGTGGGG
CTGTATGGCTTCATGCTCAGCATATCGCCTCGACTCACCCTCCTTTCTCTGCTGCACATGCCCTTCACAA
TAGCAGCGGAGAAGGTGTACAACACCCGCCATCAGGAAGTGCTTCGGGAGATCCAGGATGCAGTGGCCAG
GGCGGGGCAGGTGGTGCGGGAAGCCGTTGGAGGGCTGCAGACCGTTCGCAGTTTTGGGGCCGAGGAGCAT
GAAGTCTGTCGCTATAAAGAGGCCCTTGAACAATGTCGGCAGCTGTATTGGCGGAGAGACCTGGAACGCG
CCTTGTACCTGCTCGTAAGGAGGGTGCTGCACTTGGGGGTGCAGATGCTGATGCTGAGCTGTGGGCTGCA
GCAGATGCAGGATGGGGAGCTCACCCAGGGCAGCCTGCTTTCCTTTATGATCTACCAGGAGAGCGTGGGG
AGCTATGTGCAGACCCTGGTATACATATATGGGGATATGCTCAGCAACGTGGGAGCTGCAGAGAAGGTTT
TCTCCTACATGGACCGACAGCCAAATCTGCCTTCACCTGGCACGCTTGCCCCCACCACTCTGCAGGGGGT
TGTGAAATTCCAAGACGTCTCCTTTGCATATCCCAATCGCCCTGACAGGCCTGTGCTCAAGGGGCTGACG
TTTACCCTACGTCCTGGTGAGGTGACGGCGCTGGTGGGACCCAATGGGTCTGGGAAGAGCACAGTGGCTG
CCCTGCTGCAGAATCTGTACCAGCCCACAGGGGGACAGGTGCTGCTGGATGAAAAGCCCATCTCACAGTA
TGAACACTGCTACCTGCACAGCCAGGTGGTTTCAGTTGGGCAGGAGCCTGTGCTGTTCTCCGGTTCTGTG
AGGAACAACATTGCTTATGGGCTGCAGAGCTGCGAAGATGATAAGGTGATGGCGGCTGCCCAGGCTGCCC
ACGCAGATGACTTCATCCAGGAAATGGAGCATGGAATATACACAGATGTAGGGGAGAAGGGAAGCCAGCT
GGCTGCGGGACAGAAACAACGTCTGGCCATTGCCCGGGCCCTTGTACGAGACCCGCGGGTCCTCATCCTG
GATGAGGCTACTAGTGCCCTAGATGTGCAGTGCGAGCAGGCCCTGCAGGACTGGAATTCCCGTGGGGATC
GCACAGTGCTGGTGATTGCTCACAGGCTGCAGGCAGTTCAGCGCGCCCACCAGATCCTGGTGCTCCAGGA
GGGCAAGCTGCAGAAGCTTGCCCAGCTCCAGGAGGGACAGGACCTCTATTCCCGCCTGGTTCAGCAGCGG
CTGATGGACTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_000544 unedited
CACAATTTGTATACGACTCACTATAGGCGGCCCGCGAATTCGCACGAGGCGGTAGCGAGG
TTGGGAGAGACGGAGCGGACCTCAGCGCTGAAGCAGAAGCCCCCGGAGCTGCGGTCTCCC
CGCCGCGGCTGAGCCATGCGGCTCCCTGACCTGAGACCCTGGACCTCCCTGCTGCTGGTG
GACGCGGCTTTACTGTGGCTGCTTCAGGGCCCTCTGGGGACTTTGCTTCCTCAAGGGCTG
CCAGGACTATGGCTGGAGGGGACCCTGCGGCTGGGAGGGCTGTGGGGGCTGCTAAAGCTA
AGAGGGCTGCTGGGATTTGTGGGGACACTGCTGCTCCCGCTCTGTCTGGCCACCCCCCTG
ACTGTCTCCCTGAGAGCCCTGGTCGCGGGGGCCTCACGTGCTCCCCCAGCCAGAGTCGCT
TCAGCCCCTTGGAGCTGGCTGCTGGTGGGGTACGGGGCTGCGGGGCTCAGCTGGTCACTG
TGGGCTGTTCTGAGCCCTCCTGGAGCCCAGGAGAAGGAGCAGGACCAGGTGAACAACAAA
GTCTTGATGTGGAGGCTGCTGAAGCTCTCCAGGCCGGACCTGCCTCTCCTCGTTGCCGCC
TTCTTCTTCCTTGTCCTTGCTGTTTTGGGTGAGACATTAATCCCTCACTATTCTGGTCGT
GTGATTGACATCCTGNGAGGTGATTTTGACCCCCATGCCTTTGCCAGTGCCATCTTCTTC
ATGTGCCCTCTCTCCTTTGGCAGCTCACTGTCTGCANGCTGCCCGAGAGGCTGCTTCACC
TACACCATGTCTCGAATCAACTTGCNGATCCGGGAGCAGCTTTTCTCCTCCCTGCTGCGC
CCAGACCCCTCGGTTCTTCCCAGNAGACTAAGACAAGGGGAGCTGAACTCACGCCTGACC
TCCGATACCAACCTGATGAAGTAACTGGCTTCCTTTA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000544 unedited
ACCGCGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTATTTTAAAATATATGTA
TTATGCCACAAAATACTCCTCATCACCAGGCAAAGCTCTAGTCACCAGGGAATTAAGTTT
CCTGGACACAGACAGCCCCCACCCCACCCCACCCCACCTTTCCACCCCACCAAAAGCACA
CAGTGTCCAAATCTCCATCATGCCTGCAACTCAGGAACAGCTATCTGGCCGCACAGCTCT
AGGGAAACTCAAAGCAGGAACAGCTCTGGGTCCTGGAGACGCCCCTGAGAAGAGGGCCCA
GTATCCCTGGGGCCTCAGTCCATCAGCCGCTGCTGCACCAGGCGGGAATAAAGGTCCTGT
CCCTCCTAGAGCTGGGCAAGCTTTCTGCAGCTTGCCCTCCTGGAACACCCAGGATCTGGT
GGGCGCGCTGAACTGTCTGCAGCCTGTGAGCAATCACCACCACTGTGCGATCCCCACGGG
AATTCCATTCCTGCAGGGCCTGCTTTCACTTGCCATTTAGGCACTAGTTCCCCTCTCTCA
CTATGATGACCCTTCGGTTTCTCCATGGCCCGCGCCTTGTCCATACTTTGTTTTTGTCCC
GGCAATACATTGGCTCCCCTTCTCCCGACCTCTGGGGTATTCCCATGCCCCCATTCCCGC
ATGAAAAATCGGCGTGGACATCTGGCCAGCGCCTCACCTTTTATTCCTGTAATCTTCCTA
CCCATAACATCGTTTTTTCTACAATAACTCGTTATAATATATGTTTTTGCCAACTTAAAC
CCTCGGTTCTGCGCTTCCACGCTATTCCCGTNCATGGCTCTTGCCCCTCTCCCCTCGTCC
TCTTTGTCCTCTCATCTCCTCCCACAGCTACCCTTTGTTTTCCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000544
ORF Size 2112 bp
Insert Size 2380
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000544.3, NP_000535
RefSeq Size 5679
Locus ID 6891
Cytogenetics 6p21.32
Domains ABC_membrane, ABC_tran, AAA
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters, Antigen processing and presentation, Primary immunodeficiency
Gene Summary Involved in the transport of antigens from the cytoplasm to the endoplasmic reticulum for association with MHC class I molecules. Also acts as a molecular scaffold for the final stage of MHC class I folding, namely the binding of peptide. Nascent MHC class I molecules associate with TAP via tapasin. Inhibited by the covalent attachment of herpes simplex virus ICP47 protein, which blocks the peptide-binding site of TAP. Inhibited by human cytomegalovirus US6 glycoprotein, which binds to the lumenal side of the TAP complex and inhibits peptide translocation by specifically blocking ATP-binding to TAP1 and prevents the conformational rearrangement of TAP induced by peptide binding. Inhibited by human adenovirus E3-19K glycoprotein, which binds the TAP complex and acts as a tapasin inhibitor, preventing MHC class I/TAP association. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1, B allele) represents the longer transcript and encodes the longest isoform (1). An allele (variant 1, A allele) exists in which a single nt change creates an internal stop codon, leading to a protein that is 17 aa shorter at the C-terminus.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.