WNT4 (NM_030761) Human Untagged Clone

CAT#: SC109791

Reviews ()
Write a review

WNT4 (untagged)-Human wingless-type MMTV integration site family, member 4 (WNT4)



  "NM_030761" in other vectors (4)

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name WNT4 (NM_030761) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol WNT4
Synonyms SERKAL; WNT-4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_030761 edited
ATGAGTCCCCGCTCGTGCCTGCGTTCGCTGCGCCTCCTCGTCTTCGCCGTCTTCTCAGCC
GCCGCGAGCAACTGGCTGTACCTGGCCAAGCTGTCGTCGGTGGGGAGCATCTCAGAGGAG
GAGACGTGCGAGAAACTCAAGGGCCTGATCCAGAGGCAGGTGCAGATGTGCAAGCGGAAC
CTGGAAGTCATGGACTCGGTGCGCCGCGGTGCCCAGCTGGCCATTGAGGAGTGCCAGTAC
CAGTTCCGGAACCGGCGCTGGAACTGCTCCACACTCGACTCCTTGCCCGTCTTCGGCAAG
GTGGTGACGCAAGGGACTCGGGAGGCGGCCTTCGTGTACGCCATCTCTTCGGCAGGTGTG
GCCTTTGCAGTGACGCGGGCGTGCAGCAGTGGGGAGCTGGAGAAGTGCGGCTGTGACAGG
ACAGTGCATGGGGTCAGCCCACAGGGCTTCCAGTGGTCAGGATGCTCTGACAACATCGCC
TACGGTGTGGCCTTCTCACAGTCGTTTGTGGATGTGCGGGAGAGAAGCAAGGGGGCCTCG
TCCAGCAGAGCCCTCATGAACCTCCACAACAATGAGGCCGGCAGGAAGGCCATCCTGACA
CACATGCGGGTGGAATGCAAGTGCCACGGGGTGTCAGGCTCCTGTGAGGTAAAGACGTGC
TGGCGAGCCGTGCCGCCCTTCCGCCAGGTGGGTCACGCACTGAAGGAGAAGTTTGATGGT
GCCACTGAGGTGGAGCCACGCCGCGTGGGCTCCTCCAGGGCACTGGTGCCACGCAACGCA
CAGTTCAAGCCGCACACAGATGAGGACCTGGTGTACTTGGAGCCTAGCCCCGACTTCTGT
GAGCAGGACATGCGCAGCGGCGTGCTGGGCACGAGGGGCCGCACATGCAACAAGACGTCC
AAGGCCATCGACGGCTGTGAGCTGCTGTGCTGTGGCCGCGGCTTCCACACGGCGCAGGTG
GAGCTGGCTGAACGCTGCAGCTGCAAATTCCACTGGTGCTGCTTCGTCAAGTGCCGGCAG
TGCCAGCGGCTCGTGGAGTTGCACACGTGCCGATGA
>OriGene 5' read for NM_030761 unedited
NNGGTTCAAAATTTGTATACGACTCACTATAGGCGGCCGCGNAATTCGCACGAGGTCTGG
TCCGCGCCGGGCAGCGGGCGCAGCAGCGGGCAGGCTGCCGGCAGGCACACGGAGGCAGAG
CCCCGCCGCGCGCGCCCCGGCCCGCCCGCGGGCGCCCACCTGCAGCCCCGACGGGAGGCC
CCCCGCGGCCGCAGCCGCTGCCCCGGGCCGGGCGCCCGCGGCGGCACCATGAGTCCCCGC
TCGTGCCTGCGTTCGCTGCGCCTCCTCGTCTTCGCCGTCTTCTCAGCCGCCGCGAGCAAC
TGGCTGTACCTGGCCAAGCTGTCGTCGGTGGGGAGCATCTCAGAGGAGGAGACGTGCGAG
AAACTCAAGGGCCTGATCCAGAGGCAGGTGCAGATGTGCAAGCGGAACCTGGAAGTCATG
GACTCGGTGCGCCGCGGTGCCCAGCTGGCCATTGAGGAGTGCCAGTACCAGTTCCGGAAC
CGGCGCTGGAACTGCTCCACACTCGACTCCTTGCCCGTCTTCGGCAAGGTGGTGACGCAA
GGGACTCGGGAGGCGGCCTTCGTGTACGCCATCTCTTCGGCAGGTGTGGCCTTTGCAGTG
ACGCGGGCGTGCAGCAGTGGGGAGCTGGAGAAGTGCGGCTGTGACAGGACAGTGCATGGG
GTCAGCCCACAGGGCTTCCAGGGGTCAGGATGCTCTGACACATCGCCTACGGTGTGGCCT
TTCTACAGTCTTTGTGGATGTGCCGGAAAGAGCAAGGGGGCCTCGTCCAGCAAAGCCCTC
ATGAACCCTCACACCATGAGGCCGGCAGAAGGCCTCCTGACACACATGCGGTGGATGGAA
GGCCACGGGGTGGAAGCTCCTGTAGGAAAAAACGGCTGGGAAGCCCGCCGCCCTTCGCCA
GGGGGTACCCCCTGAAGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_030761
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030761.3, NP_110388.2
RefSeq Size 1595 bp
RefSeq ORF 1056 bp
Locus ID 54361
Cytogenetics 1p36.12
Domains wnt
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
Gene Summary The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and is the first signaling molecule shown to influence the sex-determination cascade. It encodes a protein which shows 98% amino acid identity to the Wnt4 protein of mouse and rat. This gene and a nuclear receptor known to antagonize the testis-determining factor play a concerted role in both the control of female development and the prevention of testes formation. This gene and another two family members, WNT2 and WNT7B, may be associated with abnormal proliferation in breast tissue. Mutations in this gene can result in Rokitansky-Kuster-Hauser syndrome and in SERKAL syndrome. [provided by RefSeq, Jul 2008]

Citations (1)

Other Versions

Other products for "WNT4"
Frequently bought together (2)
Goat Polyclonal Antibody against WNT4
    • 100 ug

USD 375.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools