TCF7L2 (NM_030756) Human Untagged Clone

CAT#: SC109746

TCF7L2 (untagged)-Human transcription factor 7-like 2 (T-cell specific, HMG-box) (TCF7L2), transcript variant 2

USD 958


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TCF7L2 (NM_030756) Human Untagged Clone
Symbol TCF7L2
Synonyms TCF-4; TCF4
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_030756 edited
ATGCCGCAGCTGAACGGCGGTGGAGGGGATGACCTAGGCGCCAACGACGAACTGATTTCC
TTCAAAGACGAGGGCGAACAGGAGGAGAAGAGCTCCGAAAACTCCTCGGCAGAGAGGGAT
TTAGCTGATGTCAAATCGTCTCTAGTCAATGAATCAGAAACGAATCAAAACAGCTCCTCC
GATTCCGAGGCGGAAAGACGGCCTCCGCCTCGCTCCGAAAGTTTCCGAGACAAATCCCGG
GAAAGTTTGGAAGAAGCGGCCAAGAGGCAAGATGGAGGGCTCTTTAAGGGGCCACCGTAT
CCCGGCTACCCCTTCATCATGATCCCCGACCTGACGAGCCCCTACCTCCCCAACGGATCG
CTCTCGCCCACCGCCCGAACCTATCTCCAGATGAAATGGCCACTGCTTGATGTCCAGGCA
GGGAGCCTCCAGAGTAGACAAGCCCTCAAGGATGCCCGGTCCCCATCACCGGCACACATT
GTCTCTAACAAAGTGCCAGTGGTGCAGCACCCTCACCATGTCCACCCCCTCACGCCTCTT
ATCACGTACAGCAATGAACACTTCACGCCGGGAAACCCACCTCCACACTTACCAGCCGAC
GTAGACCCCAAAACAGGAATCCCACGGCCTCCGCACCCTCCAGATATATCCCCGTATTAC
CCACTATCGCCTGGCACCGTAGGACAAATCCCCCATCCGCTAGGATGGTTAGTACCACAG
CAAGGTCAACCAGTGTACCCAATCACGACAGGAGGATTCAGACACCCCTACCCCACAGCT
CTGACCGTCAATGCTTCCATGTCCAGGTTCCCTCCCCATATGGTCCCACCACATCATACG
CTACACACGACGGGCATTCCGCATCCGGCCATAGTCACACCAACAGTCAAACAGGAATCG
TCCCAGAGTGATGTCGGCTCACTCCATAGTTCAAAGCATCAGGACTCCAAAAAGGAAGAA
GAAAAGAAGAAGCCCCACATAAAGAAACCTCTTAATGCATTCATGTTGTATATGAAGGAA
ATGAGAGCAAAGGTCGTAGCTGAGTGCACGTTGAAAGAAAGCGCGGCCATCAACCAGATC
CTTGGGCGGAGGTGGCATGCACTGTCCAGAGAAGAGCAAGCGAAATACTACGAGCTGGCC
CGGAAGGAGCGACAGCTTCATATGCAACTGTACCCCGGCTGGTCCGCGCGGGATAACTAT
GGAAAGAAGAAGAAGAGGAAAAGGGACAAGCAGCCGGGAGAGACCAATGAACACAGCGAA
TGTTTCCTAAATCCTTGCCTTTCACTTCCTCCGATTACAGACCTGAGCGCTCCTAAGAAA
TGCCGAGCGCGCTTTGGCCTTGATCAACAGAATAACTGGTGCGGCCCTTGCAGGAGAAAA
AAAAAGTGCGTTCGCTACATACAAGGTGAAGGCAGCTGCCTCAGCCCAACCTCTTCAGAT
GGAAGCTTACTAGATTCGCCTCCCCCCTCCCCGAACCTGCTAGGCTCCCCTCCCCGAGAC
GCCAAGTCACAGACTGAGCAGACCCAGCCTCTGTCGCTGTCCCTGAAGCCCGACCCCCTG
GCCCACCTGTCCATGATGCCTCCGCCACCCGCCCTCCTGCTCGCTGAGGCCACCCACAAG
GCCTCCGCCCTCTGTCCCAACGGGGCCCTGGACCTGCCCCCAGCCGCTTTGCAGCCTGCC
GCCCCCTCCTCATCAATTGCACAGCCGTCGACTTCTTCCTTACATTCCCACAGCTCCCTG
GCCGGGACCCAGCCCCAGCCGCTGTCGCTCGTCACCAAGTCTTTAGAATAG
Tag Tag Free
ACCN NM_030756
ORF Size 1791 bp
Insert Size 2600
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_030756.3. This SNP changes amino acid from P to T.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_030756.1, NP_110383
RefSeq Size 2444
RefSeq ORF 1791
Locus ID 6934
Cytogenetics 10q25.2-q25.3
Domains HMG
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Wnt signaling pathway, Adherens junction, Melanogenesis, Pathways in cancer, Colorectal cancer, Endometrial cancer, Prostate cancer, Thyroid cancer, Basal cell carcinoma, Acute myeloid leukemia, Arrhythmogenic right ventricular cardiomyopathy (ARVC)
Gene Summary This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
Transcript Variant: This variant (2) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 2, which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations