ERK2(MAPK1) (NM_138957) Human Untagged Clone

CAT#: SC109616

MAPK1 (untagged)-Human mitogen-activated protein kinase 1 (MAPK1), transcript variant 2

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ERK2(MAPK1) (NM_138957) Human Untagged Clone
Symbol MAPK1
Synonyms ERK; ERK-2; ERK2; ERT1; MAPK2; p38; p40; p41; p41mapk; p42-MAPK; P42MAPK; PRKM1; PRKM2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_138957 edited
ATGGCGGCGGCGGCGGCGGCGGGCGCGGGCCCGGAGATGGTCCGCGGGCAGGTGTTCGAC
GTGGGGCCGCGCTACACCAACCTCTCGTACATCGGCGAGGGCGCCTACGGCATGGTGTGC
TCTGCTTATGATAATGTCAACAAAGTTCGAGTAGCTATCAAGAAAATCAGCCCCTTTGAG
CACCAGACCTACTGCCAGAGAACCCTGAGGGAGATAAAAATCTTACTGCGCTTCAGACAT
GAGAACATCATTGGAATCAATGACATTATTCGAGCACCAACCATCGAGCAAATGAAAGAT
GTATATATAGTACAGGACCTCATGGAAACAGATCTTTACAAGCTCTTGAAGACACAACAC
CTCAGCAATGACCATATCTGCTATTTTCTCTACCAGATCCTCAGAGGGTTAAAATATATC
CATTCAGCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTGCTGCTCAACACCACC
TGTGATCTCAAGATCTGTGACTTTGGCCTGCCCCGTGTTGCAGATCCAGACCATGATCAC
ACAGGGTTCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCAGAAATTATGTTG
AATTCCAAGGGCTACACCAAGTCCATTGATATTTGGTCTGTAGGCTGCATTCTGGCAGAA
ATGCTTTCTAACAGGCCCATCTTTCCAGGGAAGCATTATCTTGACCAGCTGAACCACATT
TTGGGTATTCTTGGATCCCCATCACAAGAAGACCTGAATTGTATAATAAATTTAAAAGCT
AGGAACTATTTGCTTTCTCTTCCACACAAAAATAAGGTGCCATGGAACAGGCTGTTCCCA
AATGCTGACTCCAAAGCTCTGGACTTATTGGACAAAATGTTGACATTCAACCCACACAAG
AGGATTGAAGTAGAACAGGCTCTGGCCCACCCATATCTGGAGCAGTATTACGACCCGAGT
GACGAGCCCATCGCCGAAGCACCATTCAAGTTCGACATGGAATTGGATGACTTGCCTAAG
GAAAAGCTCAAAGAACTAATTTTTGAAGAGACTGCTAGATTCCAGCCAGGATACAGATCT
TAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_138957 unedited
CACAATTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGCACGAGGCAGGCAGGCA
GGCAATCGGTCCGAGTGGCTGTCGGCTCTTCAGCTCTCCCGCTCGGCGTCTTCCTTCCTC
CTCCCGGTCAGCGTCGGCGGCTGCACCGGCGGCGGCGCAGTCCCTGCGGGAGGGGCGACA
AGAGCTGAGCGGCGGCCGCCGAGCGTCGAGCTCAGCGCGGCGGAGGCGGCGGCGGCCCGG
CAGCCAACATGGCGGCGGCGGCGGCGGCGGGCGCGGGCCCGGAGATGGTCCGCGGGCAGG
TGTTCGACGTGGGGCCGCGCTACACCAACCTCTCGTACATCGGCGAGGGCGCCTACGGCA
TGGTGTGCTCTGCTTATGATAATGTCAACAAAGTTCGAGTAGCTATCAAGAAAATCAGCC
CCTTTGAGCACCAGACCTACTGCCAGAGAACCCTGAGGGAGATAAAAATCTTACTGCGCT
TCAGACATGAGAACATCATTGGAATCAATGACATTATTCGAGCACCAACCATCGAGCAAA
TGAAAGATGTATATATAGTACAGGACCTCATGGAAACAGATCTTTACAAGCTCTTGAAGA
CACAACACCTCAGCAATGACCATATCTGCTATTTTCTCTACCAGATCCTCAGAGGGTTAA
AATATATCCATTCAGCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTGCTGCTCA
CACCACCTGTGATCTCAAGATCTGTGACTTTGGCCTGCCCCGTGTTGCAGATCCAGACCA
TGATCACACAGGNTTCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCAGAAAT
ATGTTGAATCCCAGGGCTACACCAGTTCATTGATATTTGTCCTGTAGCTGCATTCTGGCA
AAATGCTTTCTACAGGCCATCTTTCAGGGAGCATATCCTGACAGCTGACCACATTTTGTT
ATTCTGGATC
3' Read Nucleotide Sequence
>Forward primer walk for NM_138957 unedited
AAAAAAAAGTTTTGCTCAAACCACCGTGCACTCAACTACTGTGATTTGGCCTGGCCCGTG
TTGCAGATCCATACCATGATCACCAGGGTTCCTGACAGATATGTGGCCACACGTTGGTAC
AGGGCTCCAGAAATATGTTGAATTCCAAGGGCTACACCAAGTCCATTGATATTTGGTCTG
TAGGCTGCATTCTGGCAGAAATGCTTTCTAACAGGCCCATCTTTCCAGGGAAGCATTATC
TTGACCAGCTGAACCACATTTTGGGTATTCTTGGATCCCCATCACAAGAAGACCTGAATT
GTATAATAAATTTAAAAGCTAGGAACTATTTGCTTTCTCTTCCACACAAAAATAAGGTGC
CATGGAACAGGCTGTTCCCAAATGCTGACTCCAAAGCTCTGGACTTATTGGACAAAATGT
TGACATTCAACCCACACAAGAAGATTGAAGTAGAACAGGCTCTGGCCCACCCATATCTGG
AGCAGTATTACGACCCGAGTGACGAGCCCATCGCCGAAGCACCATTCAAGTTCGACATGG
AATTGGATGACTTGCCTAAGGAAAAGCTCAAAGAACTAATTTTTGAAGAGACTGCTAGAT
TCCAGCCAGGATACAGATCTTAAATTTGTCANGACAAGGGCTCAGAAGACTGGACGTGCT
CAGACATCGGTGTTCTTCTTCCCAGTTCTTGACCCCTGGTCCTGTCTCCAGCCCGTCTTG
GCTTATCCACTTTGACTCCTTTGAGCCGTTTGGAAGGGGCGGTTTCTGGTATTTGTGGCC
TTTTATGCTTTCAAAAAATTTTTCCATTCCAGATAATTCCTCCTGGCAGCCCTGTGTGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_138957
ORF Size 1083 bp
Insert Size 5000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_138957.2, NP_620407
RefSeq Size 1499
RefSeq ORF 1083
Locus ID 5594
Cytogenetics 22q11.22
Domains pkinase, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways MAPK signaling pathway, ErbB signaling pathway, Chemokine signaling pathway, Oocyte meiosis, mTOR signaling pathway, Vascular smooth muscle contraction, Dorso-ventral axis formation, TGF-beta signaling pathway, Axon guidance, VEGF signaling pathway, Focal adhesion, Adherens junction, Gap junction, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Long-term potentiation, Neurotrophin signaling pathway, Long-term depression, Regulation of actin cytoskeleton, Insulin signaling pathway, GnRH signaling pathway, Progesterone-mediated oocyte maturation, Melanogenesis, Type II diabetes mellitus, Alzheimer's disease, Prion diseases, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Thyroid cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia, Acute myeloid leukemia, Non-small cell lung cancer
Gene Summary This gene encodes a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The activation of this kinase requires its phosphorylation by upstream kinases. Upon activation, this kinase translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. One study also suggests that this protein acts as a transcriptional repressor independent of its kinase activity. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Two alternatively spliced transcript variants encoding the same protein, but differing in the UTRs, have been reported for this gene. [provided by RefSeq, Jan 2014].
Transcript Variant: This variant (2) contains a different 3' UTR region, compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations