PML Protein(PML) (NM_033240) Human Untagged Clone

CAT#: SC109584

PML (untagged)-Human promyelocytic leukemia (PML), transcript variant 2

USD 979.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PML Protein(PML) (NM_033240) Human Untagged Clone
Symbol PML
Synonyms MYL; PP8675; RNF71; TRIM19
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_033240 edited
GAATTCGGCACGAGGCTAAACCGAGAATCGAAACTAAGCTGGGGTCCATGGAGCCTGCAC
CCGCCCGATCTCCGAGGCCCCAGCAGGACCCCGCCCGGCCCCAGGAGCCCACCATGCCTC
CCCCCGAGACCCCCTCTGAAGGCCGCCAGCCCAGCCCCAGCCCCAGCCCTACAGAGCGAG
CCCCCGCTTCGGAGGAGGAGTTCCAGTTTCTGCGCTGCCAGCAATGCCAGGCGGAAGCCA
AGTGCCCGAAGCTGCTGCCTTGTCTGCACACGCTGTGCTCAGGATGCCTGGAGGCGTCGG
GCATGCAGTGCCCCATCTGCCAGGCGCCCTGGCCCCTAGGTGCAGACACACCCGCCCTGG
ATAACGTCTTTTTCGAGAGTCTGCAGCGGCGCCTGTCGGTGTACCGGCAGATTGTGGATG
CGCAGGCTGTGTGCACCCGCTGCAAAGAGTCGGCCGACTTCTGGTGCTTTGAGTGCGAGC
AGCTCCTCTGCGCCAAGTGCTTCGAGGCACACCAGTGGTTCCTCAAGCACGAGGCCCGGC
CCCTAGCAGAGCTGCGCAACCAGTCGGTGCGTGAGTTCCTGGACGGCACCCGCAAGACCA
ACAACATCTTCTGCTCCAACCCCAACCACCGCACCCCTACGCTGACCAGCATCTACTGCC
GAGGATGTTCCAAGCCGCTGTGCTGCTCGTGCGCGCTCCTTGACAGCAGCCACAGTGAGC
TCAAGTGCGACATCAGCGCAGAGATCCAGCAGCGACAGGAGGAGCTGGACGCCATGACGC
AGGCGCTGCAGGAGCAGGATAGTGCCTTTGGCGCGGTTCACGCGCAGATGCACGCGGCCG
TCGGCCAGCTGGGCCGCGCGCGTGCCGAGACCGAGGAGCTGATCCGCGAGCGCGTGCGCC
AGGTGGTAGCTCACGTGCGGGCTCAGGAGCGCGAGCTGCTGGAGGCTGTGGACGCGCGGT
ACCAGCGCGACTACGAGGAGATGGCCAGTCGGCTGGGCCGCCTGGATGCTGTGCTGCAGC
GCATCCGCACGGGCAGCGCGCTGGTGCAGAGGATGAAGTGCTACGCCTCGGACCAGGAGG
TGCTGGACATGCACGGTTTCCTGCGCCAGGCGCTCTGCCGCCTGCGCCAGGAGGAGCCCC
AGAGCCTGCAAGCTGCCGTGCGCACCGATGGCTTCGACGAGTTCAAGGTGCGCCTGCAGG
ACCTCAGCTCTTGCATCACCCAGGGGAAAGATGCAGCTGTATCCAAGAAAGCCAGCCCAG
AGGCTGCCAGCACTCCCAGGGACCCTATTGACGTTGACCTGGATGTCTCCAATACAACGA
CAGCCCAGAAGAGGAAGTGCAGCCAGACCCAGTGCCCCAGGAAGGTCATCAAGATGGAGT
CTGAGGAGGGGAAGGAGGCAAGGTTGGCTCGGAGCTCCCCGGAGCAGCCCAGGCCCAGCA
CCTCCAAGGCAGTCTCACCACCCCACCTGGATGGACCGCCTAGCCCCAGGAGCCCCGTCA
TAGGAAGTGAGGTCTTCCTGCCCAACAGCAACCACGTGGCCAGTGGCGCCGGGGAGGCAG
AGGAACGCGTTGTGGTGATCAGCAGCTCGGAAGACTCAGATGCCGAAAACTCGGTGAGTG
GCCCAGAAGTTCAGCCCAGGACTCCTGCCTCCCCCCATTTCAGGTCCCAGGGGGCACAGC
CACAGCAGGTGACTCTCAGACTTGCCTTGCGCCTGGGGAATTTTCCAGTGAGGCATTGAG
TCCCAAGCTGTGCTGAGGACAGTCTCCAAATGACAGCTGCATGCCTGGACCACCCCAGCC
CTCCCACTACACCAGGGCCAGGAGCTCTTCTGAAATGCTGATAGCATGTGTCCAGAGCCC
TGTCTCTTTTCTGGAATGTCCAAGACCTTTGTCTGGAGCTTCCTTATGCATTTTCTGTCC
TCTAAGTCCTCAGTGAGGAGGGCTGGACAAGAATCCATTCCTTGGTTTATTACAGCCAGT
GGGGGCCAGTGAAGGGGTGTCAGGCCACAGGGCAGCTATATAGGGGCCAAACAAGTGAGG
TTTGACTCCATCCATGTAGAAAGATATATAAATCCATTCCACAGTGAAACAGGTGGCCTC
GTGGGTAGTGACCCTTCTGTCCCTAGAGGTTTATTACTAGAGGCTGGACTATCACCTGTC
CAGGGGAAAAGGGGATCTGAATAGAGTGAAAGGTTGGACTGGGTGGCCCCTGAGGTCTCT
TCCAGCCCTCAGTCTGAGGTTCTGTATTGGAAAGTGCATGGAGCCCATGGAGACCGCCGA
GCCACAGTCCTCGCCAGCCCACTCCTCGCCAGCCCACTCCTCGCCAGCCCACTCCTCGCC
AGTCCAGTCTCTGCTGAGAGCACAAGGAGCCTCCAGCCTGCCCTGTGGCACATACCACCC
CCCAGCTTGGCCTCCCCACCAGCCCGCTGAGCAGGCTGCCACCCCCGATGCTGAGCCTCA
CAGCGAGCCTCCTGATCACCAGGAGCGCCCTGCCGTCCACCGTGGGATCCGCTACCTGTT
GTACAGAGCACAGAGAGCCATCCGCCTTCGCCATGCCCTCCGCTTGCACCCTCAATTGCA
TCGGGCCCCTATTCGGACTTGGTCTCCCCATGTGGTCCAAGCCAGCACTCCTGCCATCAC
AGGGCCCCTCAACCATCCTGCCAATGCCCAGGAACATCCTGCCCAGCTGCAAAGGGGCAT
CAGCCCACCCCACCGGATACGAGGGGCTGTGCGATCCCGCAGCCGCTCCCTCCGGGGCTC
CTCCCATTTATCCCAGTGGCTCAACAACTTTTTTGCCCTCCCCTTCTCCTCCATGGCTTC
CCAGCTTGACATGTCTTCCGTGGTGGGGGCAGGGGAAAGCAGAGCCCAGACTCTTGGAGC
AGGTGTTCCCCCTGGGGACTCTGTCAGAGGCTCCATGGAGGCCTCTCAAGTCCAAGTGCC
TCTGGAAGCCTCTCCAATTACATTCCCACCACCCTGTGCCCCAGAAAGGCCCCCCATCAG
CCCAGTCCCAGGCGCCCGTCAAGCAGGCCTCTGAGAGTGCTACCCTTCTCTTGTAACCTT
GCAGCCAACACCCCTGCCCGGCCCCTGAGCTGCCTCCTCCAGCCCATGCTCTTACAGGCC
CTGCACAGAGTAGCACTCATTAATTCTTGGTTAAGGAATGAATCAACGAATGAATGGCTA
TGCATGGACCTCTGGGCAGGGAGACCTGGGTCTTCTCTGGCTGAGAGGGGAAGGCTAAGG
CATGGCTGAGATTCAAGCCACCATTCCAGGCCTCTTTGCCCAAGAAAGAAACTTCTGTCA
CCCTTGCACTCTCCTGTATTCTGAGTCCCTGGCCAATAGCACAGCCTTCCATGCCCCGAC
CCCCACCCCAAGCCTCTCCACTAGGCCTCTGCCAGGATCTAAGCCCATGAGCACAGGGAC
TGGCTATCCCAAGACCTGGCAGATGTGGCTGCTCAATAAACACTTGTTGAACCATCAAAA
AAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_033239 unedited
TGGATTTGTATACGACTTCTATAGGGCGGCCGCGAATTCGCACGAGGCTAAACCGATAAT
CGAAACTAAGCTGGGGTCCATGGAGCCTGCACCCGCCCGATCTCCGAGGCCCCAGCAGGA
CCCCGCCCGGCCCCAGGAGCCCACCATGCCTCCCCCCGAGACCCCCTCTGAAGGCCGCCA
GCCCAGCCCCAGCCCCAGCCCTACAGAGCGAGCCCCCGCTTCGGAGGAGGAGTTCCAGTT
TCTGCGCTGCCAGCAATGCCAGGCGGAAGCCAAGTGCCCGAAGCTGCTGCCTTGTCTGCA
CACGCTGTGCTCAGGATGCCTGGAGGCGTCGGGCATGCAGTGCCCCATCTGCCAGGCGCC
CTGGCCCCTAGGTGCAGACACACCCGCCCTGGATAACGTCTTTTTCGAGAGTCTGCAGCG
GCGCCTGTCGGTGTACCGGCAGATTGTGGATGCGCAGGCTGTGTGCACCCGCTGCAAAGA
GTCGGCCGACTTCTGGTGCTTTGAGTGCGAGCAGCTCCTCTGCGCCAAGTGCTTCGAGGC
ACACCAGTGGTTCCTCAAGCACGAGGCCCGGCCCCTAGCAGAGCTGCGCAACCAGTCGGT
GCGTGAGTTCCTGGACGGCACCCGCAAGACCAACAACATCTTCTGCTCCAACCCCAACCA
CCGCACCCCTACGCTGACCAGCATCTACTGCCGAGGATGTTCCAAGCCGCTGTGCTGCTC
GTGCGCGCTCCTTGACAGCAGCCACAGTGAGCTCAAGTGCGACATCAGCGCAGAGATCCA
GCAGCGACAGGAGGGAGCTGGACGCCATGACGCANGCGCTGCANGAGCANGATAGTGCCC
TTGGGCGCGGTTCACGCGCAGATGCACGCGNNCGTCGNCANCTGGGCCGCGCGCGTGCCG
AGACCGAGGAGCTGATCCGGAGCGCGTGCGCCAGTGGTAGCTCACGTGCGGGCCTCAGAA
CGCGACTGCTGNAGGCTGTGGACNCNCGTACCNCGCGN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_033239 unedited
TACCGCGGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTGATGGTTCAACAAGT
GTTTATTGAGCAGCCACATCTGCCAGGTCTTGGGATAGCCAGTCCCTGTGCTCATGGGCT
TAGATCCTGGCAGAGGCCTAGTGGAGAGGCTTGGGGTGGGGGTCGGGGCATGGAAGGCTG
TGCTATTGGCCAGGGACTCAGAATACAGGAGAGTGCAAGGGTGACAGAAGTTTCTTTCTT
GGGCAAAGAGGCCTGGAATGGTGGCTTGAATCTCAGCCATGCCTTAGCCTTCCCCTCTCA
GCCAGAGAAGACCCAGGTCTCCCTGCCCAGAGGTCCATGCATAGCCATTCATTCGTTGAT
TCATTCCTTAACCAAGAATTAATGAGTGCTACTCTGTGCAGGGCCTGTAAGAGCATGGGC
TGGAGGAGGCAGCTCAGGGGCCGGGCAGGGGTGTTGGCTGCAAGGTTACAAGAGAAGGGT
AGCACTCTCAGAGGCCTGCTTGACGGGCGCCTGGGACTGGGCTGATGGGGGGCCTTTCTG
GGGCACAGGGTGGTGGGAATGTAATTGGAGAGGCTTCCAGAGGCACTTGGACTTGAGAGG
CCTCCATGGAGCCTCTGACAGAGTCCCCAGGGGGAACACCTGCTCCAAGAGTCTGGGCTC
TGCTTTTCCCTGCCCCCACCACGGAAGACATGTCAAGCTGGGAAGCCATGGAGGAGAAGG
GAGGGCCAAAAAGTTGTGAGCCACTGGGATAAATGGGAGGAACCCCCGGAGGAGCCGCTG
CGGGATCGCACAACCCCTCGTATCCGGTGGGGTTGGGCTGAAGCCCTTTTGCACTGGGCA
GGATGTTCCTGGGCATTGCAGGATGTTGAGGGCCCTGTGAAGCGGATGGCTGGCTTGACC
CATGGGAAACCAGTCCCAATGGGCCCGAGCACT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_033240
ORF Size 1836 bp
Insert Size 3630
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_033240.2, NP_150243
RefSeq Size 3751
Locus ID 5371
Cytogenetics 15q24.1
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis, Pathways in cancer, Acute myeloid leukemia
Gene Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) differs in the 3' UTR and the 3' coding region compared to variant 1. The resulting isoform (2, also known PML-2, PML-V and TRIM19beta) contains a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.