gamma Catenin(JUP) (NM_002230) Human Untagged Clone

CAT#: SC109362

JUP (untagged)-Human junction plakoglobin (JUP), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name gamma Catenin(JUP) (NM_002230) Human Untagged Clone
Symbol JUP
Synonyms ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC109362 sequence for NM_002230 edited (data generated by NextGen Sequencing)
ATGGAGGTGATGAACCTGATGGAGCAGCCTATCAAGGTGACTGAGTGGCAGCAGACATNC
ACCTACGACNCGGGTATCCACTCGGGCGCCAACACCTGCGTGCCCTCCGTCAGCAGCAAG
GGCATCATGGAGGAGGATGAGGCCTGCGGGCGCCAGTACACGCTCAAGAAAACCACCACT
TACACCCAGGGGGTGCCCCCCAGCCAAGGTGATCTGGAGTACCAGATGTCCACAACAGCC
AGGGCCAAACGGGTGCGGGAGGCCATGTGCCCTGGTGTGTCAGGCGAGGACAGCTCGCTT
CTGCTGGCCACCCAGGTGGAGGGGCAGGCCACCAACCTGCAGCGACTGGCCGAGCCGTCC
CAGCTGCTCAAGTCGGCCATTGTGCATCTCATCAACTACCAGGACGATGCCGAGCTGGCC
ACTCGCGCCCTGCCCGAGCTCACCAAACTGCTCAACGACGAGGACCCGGTGGTGGTGACC
AAGGCGGCCATGATTGTGAACCAGCTGTCGAAGAAGGAGGCGTCGCGGCGGGCCCTGATG
GGCTCGCCCCAGCTGGTGGCCGCTGTCGTGCGTACCATGCAGAATACCAGCGACCTGGAC
ACAGCCCGCTGCACCACCAGCATCCTGCACAACCTCTCCCACCACCGGGAGGGGCTGCTC
GCCATCTTCAAGTCGGGTGGCATCCCTGCTCTGGTCCGCATGCTCAGCTCCCCTGTGGAG
TCGGTCCTGTTCTATGCCATCACCACGCTGCACAACCTGCTCCTGTACCAGGAGGGCGCC
AAGATGGCCGTGCGCCTGGCCGACNGGCTGCAAAAGATGGTGCCCCTGCTCAACAAGAAC
AACCCCAAGTTCCTGGCCATCACCACCGACTGCCTGCAGCTCCTGGCCTACGGCAACCAG
GAGAGCAAGCTGATCATCCTGGCCAATGGTGGGCCCCAGGCCCTCGTGCAGATCATGCGT
AACTACAGTTATGAAAAGCTGCTCTGGACCACCAGTCGTGTGCTCAAGGTGCTATCCGTG
TGTCCCAGCAATAAGCCTGCCATTGTGGAGGCTGGTGGGATGCAGGCCCTGGGCAAGCAC
CTGACCAGCAACAGCCCCCGCCTGGTGCAGAACTGCCTGTGGACCCTGCGCAACCTCTCA
GATGTGGCCACCAAGCAGGAGGGCCTGGAGAGTGTGCTGAAGATTCTGGTGAATCAGCTG
AGTGTGGATGACGTCAACGTCCTCACCTGTGCCACGGGCACACTCTCCAACCTGACATGC
AACAACAGCAAGAACAAGACGCTGGTGACACAGAACAGCGGTGTGGAGGCTCTCATCCAT
GCCATCCTGCGTGCTGGTGACAAGGACGACATCACGGAGCCTGCCGTCTGCGCTCTGCGC
CACCTCACTAGCCGCCACCCTGAGGCCGAGATGGCCCAGAACTCTGTGCGTCTCAACTAT
GGCATCCCAGCCATCGTGAAGCTGCTCAACCAGCCCAACCAGTGGCCACTGGTCAAGGCA
ACCATCGGCTTGATCAGGAATCTGGCCCTGTGCCCAGCCAACCATGCCCCGCTGCAGGAG
GCAGCGGTCATCCCCCGCCTCGTCCAACTGCTGGTGAAGGCCCACCAGGATGCCCAGCGC
CACGTAGCTGCAGGCACACAGCAGCCCTACACGGATGGTGTGAGGATGGAGGAGATTGTG
GAGGGCTGCACCGGAGCACTGCACATCCTCGCCCGGGACCCCATGAACCGCATGGAGATC
TTCCGGCTCAACACCATTCCCCTGTTTGTGCAGCTCCTGTACTCGTCGGTGGAGAACATC
CAGCGCGTGGCTGCCGGGGTGCTGTGTGAGCTGGCCCAGGACAAGGAGGCGGCCGACGCC
ATTGATGCAGAGGGGGCCTCGGCCCCACTCATGGAGTTGCTGCACTCCCGCAACGAGGGC
ACTGCCACCTACGCTGCTGCCGTCCTGTTCCGCATCTCCGAGGACAAGAACCCAGACTAC
CGGAAGCGCGTGTCCGTGGAGCTCACCAACTCCCTCTTCAAGCATGACCCGGCTGCCTGG
GAGGCTGCCCAGAGCATGATTCCCATCAATGAGCCCTATGGAGATGACATGGATGCCACC
TACCGCCCCATGTACTCCAGCGATGTGCCCCTTGACCCGCTGGAGATGCACATGGACATG
GATGGAGACTACCCCATCGACACCTACAGCGACGGCCTCAGGCCCCCGTACCCCACTGCA
GACCACATGCTGGCCTAG

Clone variation with respect to NM_002230.2
59 a=>n;70 t=>n;805 g=>n
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002230 unedited
GTTTTCAGNATTTGTATACGACTCATATAGGCGGCCGCGNAATTCGCACGAGGGCCGCCC
GACCACGCCGAGCTCAGTTCGCTGTCCGCGCCGGCTCCCACCCCGGCCCGACCCCGACCC
GGCCCGGTCAGGCCCCATACTCAGGTGCGGGCTATCGGGGGCGCAGTAGCCACGATGGAG
GTGATGAACCTGATGGAGCAGCCTATCAAGGTGACTGAGTGGCAGCAGACATACACCTAC
GACTCGGGTATCCACTCGGGCGCCAACACCTGCGTGCCCTCCGTCAGCAGCAAGGGCATC
ATGGAGGAGGATGAGGCCTGCGGGCGCCAGTACACGCTCAAGAAAACCACCACTTACACC
CAGGGGGTGCCCCCCAGCCAAGGTGACCTGGAGTACCAGATGTCCACAACAGCCAGGGCC
AAACGGGTGCGGGAGGCCATGTGCCCTGGTGTGTCAGGCGAGGACAGCTCGCTTCTGCTG
GCCACCCAGGTGGAGGGGCAGGCCACCAACCTGCAGCGACTGGCCGAGCCGTCCCAGCTG
CTCAAGTCGGCCATTGTGCATCTCATCAACTACCAGGACGATGCCGAGCTGGCCACTCGC
GCCCTGCCCGAGCTCACCAAACTGCTCAACGACGAGGACCCGGTGGTGGTGACCAAGGCG
GCCATGATTGTGAACCAGCTGTCGAAGAAGGAGGCGTCGCGGCGGGCCCTGATGGGCTCG
CCCCAGCTGGTGGCCGCTGTCGTGCGTACCATGCAGAATACCAGCGACCTGGACACAGCC
CGCTGCACCACCAGCATCCTGCACAACCTCTCCCACCACCGGGNAGGGGCTGCTCGCCAT
CTTCAAAGTCGGTGCCATCCCTGCTCTGGTCCGCATGCTCAGCTCCCCTGTGGNAGTCGG
TCCTGTTCTATG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002230 unedited
GTTTTTCTTTTCTTTGCTTTGGTCCTATACCAAAAAAACCAATAACCAAAAACATAAAGC
GATAATAATAAAACACTCTGCTTGGACCTCCCCCAGCCCCCCACACCATGTGCGGGAAAT
GGGGGGGTCTGAAACAGGAAGGGGAAGAGAAAGCCCCTCACCACACACCAGAGGGGTCAG
CCAAGAGCACTTCTCGGGGTCAGCTAGGGCAGCTGTGTGGGTGGGACAGGGGTGTGAGGA
AGCTGTCCCCAGAGCTCCCTGGGGAGTGAGGGGTGGGCAAAGCCAACTAAGCACCCTGGA
GAGAGAAGCTGGCATCTTCTGGAGCAGGTGACTCACTCCATATCTCCTCCCCATCTCCCC
TGGACGGTCCCTGAACTTTTCAAGAGAAGTTTTGGATTTTGGGGGTTTGGGTCTCGAACC
TGGGCCCTGGAGGCCCTGGGGGCTTAGGGCAGTTGGTCGGTGGAGTTCAGTGAGAAAATC
AGACCCAGAGAAGGAACCAAAGCCCTTCCGGGCCCAGGCAGCTGGAGACAGGGAGGCTGG
AGGTTTGGAGGGGCGTTGCTGGGGGAAAACAGAATGGGTACTTGAGTCTGAAGCTTTAGT
GGCCAGGGCCACAGGGGCGGGGAGGGGGTGTCAGGCCCTGGACCCATGCCCCGGACAGAA
AAGCAGGAGCAGCACACTATCCCCAAGAAGACCCCTCCGAGGACCTCTGGAAGCCCCAGG
TGCACCACGTAATTTCACCCCGGCTTCCCCCAATTAAGCACTTTTTTGTCCTGCCCCTCG
CCTGCCCGCTAGCCTCTCCCATGAGAACGCCCCTGGCCCCAGCCTCCTAGTCCNCAGTGG
CCTCCTTCGGGCTCCGCGCCCTAGCCGCCCCCCTTGCTCCCTGGCGTATCCCCTTCCTGC
CCATTTCTCTTCCCCCCTCAGGGCTCCCTCCTTCCCCCCCCCCTTTCCCTCTTTCCCCCC
TTCGCCCCTGTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002230
ORF Size 2238 bp
Insert Size 3090
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002230.1, NP_002221
RefSeq Size 3490
Locus ID 3728
Cytogenetics 17q21.2
Domains ARM
Protein Families Druggable Genome
Protein Pathways Pathways in cancer, Acute myeloid leukemia, Arrhythmogenic right ventricular cardiomyopathy (ARVC)
Gene Summary This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.