Factor VIII(F8) (NM_019863) Human Untagged Clone

CAT#: SC109206

F8 (untagged)-Human coagulation factor VIII, procoagulant component (F8), transcript variant 2

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Factor VIII(F8) (NM_019863) Human Untagged Clone
Symbol F8
Synonyms AHF; DXS1253E; F8B; F8C; FVIII; HEMA
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC109206 sequence for NM_019863 edited (data generated by NextGen Sequencing)
ATGCGGATCCAAGACCCTGGGAAGGTCTTCTTTGGCAATGTGGATTCATCTGGGATAAAA
CACAATATTTTTAACCCTCCAATTATTGCTCGATACATCCGTTTGCACCCAACTCATTAT
AGCATTCGCAGCACTCTTCGCATGGAGTTGATGGGCTGTGATTTAAATAGTTGCAGCATG
CCATTGGGAATGGAGAGTAAAGCAATATCAGATGCACAGATTACTGCTTCATCCTACTTT
ACCAATATGTTTGCCACCTGGTCTCCTTCAAAAGCTCGACTTCACCTCCAAGGGAGGAGT
AATGCCTGGAGACCTCAGGTGAATAATCCAAAAGAGTGGCTGCAAGTGGACTTCCAGAAG
ACAATGAAAGTCACAGGAGTAACTACTCAGGGAGTAAAATCTCTGCTTACCAGCATGTAT
GTGAAGGAGTTCCTCATCTCCAGCAGTCAAGATGGCCATCAGTGGACTCTCTTTTTTCAG
AATGGCAAAGTAAAGGTTTTTCAGGGAAATCAAGACTCCTTCACACCTGTGGTGAACTCT
CTAGACCCACCGTTACTGACTCGCTACCTTCGAATTCACCCCCAGAGTTGGGTGCACCAG
ATTGCCCTGAGGATGGAGGTTCTGGGCTGCGAGGCACAGGACCTCTACTGA

Clone variation with respect to NM_019863.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_019863 unedited
GGTCGCATTTCGACACACGTTTCACTATAGGCGGCCGCGCAATTCCGCACGAGGCCCTGA
TGACGTGCAAAGAGCGGCATCGGAGGCGGGGCCTGGCCGGGCTGTGAGCGGCGTATGCAA
ATCGAGGGTCTCGGGGATGCGGATCCAAGACCCTGGGAAGGTCTTCTTTGGCAATGTGGA
TTCATCTGGGATAAAACACAATATTTTTAACTCTTTTTATTATTGCTCGATACATCCGTT
TGGACCCAACTCATTATAGCATTCGCAGCACTCTTCGCATGGAGTTGATGGGCTGTGATT
CGAATAGTTGCAGCATGCCATTGGGAATGGAGAGTAAAGCAATATCAGATGCACAGATTA
CTGCTTCATCCTACTTTACCAATATGTTTGCCACCTGGTCTCCTTCAAAAGCTCGACTTC
ACCTCCAAGGGAGGAGTAATGCCTGGAGACCTCAGGCGAATAATCCAAAAGAGTGGCTGC
AAGTGGACTTCCAGAAGACAATGAAAGTCACAGGAGTAACTACTCACGGAGTAAAATCTC
TGCTTACCAGCATGTATGTGAAGGAGTTTCTCATCTCCACCAGCCAAGACGGTCATCAGC
GCACTCTCTCTTTCCACAATGGGACAGTAAAGGTTCCTTAGGGAAATCAAGACTCCTTCA
CACCTGTGGTGAACTCTCTAGACCCACCGTTACTGACTCGCTACCTTCGAATTCACCCCC
ACACTTGGGTGCACCCCATTGCCCTGAGGACGGAGGTTCTGGGCTTGCAAGCACAGGACC
TTCTACTGAGGCGGCCACTGCAGCACCTGCAACTGGCGCAACTCTCCCTCCTCAGCCTCA
GGGGAGTGTCCCTCCCTGGCTTGCGTCTTACCTTCGCGCCAAACCTACCAAAACTCGCTC
TGAACCCTCCGGAATCAN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_019863 unedited
ACTATGGACCGGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTGTATGTGTC
AATGTTTTATTTAACTCATTACTGAAGAAACCAGCAGGAAAATAAAAGAGCTAGTTCCAT
GAACATTTGAGAAATAGAGATGTATATAGTCAATGGGAAAAGAATGCCAAAATAAGATTA
TTAAGTTAAACATAACAGGAAATAAAACCATATCACCTTTGGGGTTAACTCCTCTACCGG
GCTATAAAACAAAACAACTTATTCATTTCTGTAAGTTAGCCTCTAAACTTTAAGAACTTC
ACAGGGCTATAAACCATTTGCACCTGCATCATTTGTGGATTGTGACTATACTGTGACAGC
TATGTTATAGTTTCCAAAGAGGTCAGATAAGGGTCAAGCAGGATTATTAGAAAATACTCC
AGCATAGAAAAAAGTAGCCATTCTTTTGCCTTTTCTCAGATTGGGATCCATTTTTCTTTC
ATATTAGGATCTCCTGTTTTCCATTTGCCCTGGGTTGCAATCTTTGGATGCTTCCTCCAA
CTGCTCTATAACTTATCCTTGCCTCCAGCCCCCTTTACTATCAGGAGATTCTGTGTAGTC
ATAGTGAAGGGGTCAGGCAGATGGAAGGAGCAGTAAACCCTTCACAATCTTATGGGGGTG
GAGGGCAAGAANGGGGATCCTATTGTGTGGTGATATGGCAGACTGGAGTGTTTTTTCTGT
TTTCACCAGTCCAATTTTCTTCTGACCTCCTTGATATTTCAACTATGTAAGTAGGACTCT
AGGTTTCAGTCACGGTATATAATTTCCCCTGTTACATTGTTTGTTGGGTTATTTTCAGCA
GGAAATAGTAGAGGGAGAAAGTAAACTGATTGCATTATTAGATTACAAATTTGTATCTCC
TTCTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_019863
ORF Size 651 bp
Insert Size 2560
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_019863.2, NP_063916
RefSeq Size 2617
RefSeq ORF 651
Locus ID 2157
Cytogenetics Xq28
Domains F5_F8_type_C
Protein Families Secreted Protein, Druggable Genome
Protein Pathways Complement and coagulation cascades
Gene Summary This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) contains an unique 5' exon located within intron 22 of transcript variant 1. This exon codes for eight amino acids and is spliced to exons 23-26 maintaining the reading frame. The resulting isoform (b) is considerably shorter compared to isoform a, and includes the phospholipid binding domain.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.