CDC42(CDC42) (NM_001791) Human Untagged Clone

CAT#: SC109055

CDC42 (untagged)-Human cell division cycle 42 (GTP binding protein, 25kDa) (CDC42), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CDC42(CDC42) (NM_001791) Human Untagged Clone
Symbol CDC42
Synonyms CDC42Hs; G25K
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001791 edited
GAATTCGGCACGAGGCCTCGTGCCGAATTCGGCACGAGGCGCCCCGGTGGAGAAGCTGAG
ACGGAGTCTCACTGTGTTGCCCAGGCTGGAGTGCAGTGGCGCCATCTTGGCTCACTGCAG
TGCGCCTCTGCCCCCCGAGTTCAAGCGATTCTCCTGCCTCAGGCTCCTGAGTAGCTGGGA
CTACAGGTCATCATCAGATTTGAAATATTTAAAGTGGATACAAAACTATTTCAGCAATGC
AGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTGATAT
CCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTATGCAG
TCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGGCAAG
AGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTT
TTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAA
CTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATG
ACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTG
CTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACAC
AGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCAGAAC
CGAAGAAGAGCCGCAGGTGTGTGCTGCTATGAACATCTCTCCAGAGCCCTTTCTGCACAG
CTGGTGTCGGCATCATACTAAAAGCAATGTTTAAATCAAACTAAAGATTAAAAATTAAAA
TTCGTTTTTGCAATAATGACAAATGCCCTGCACCTACCCACATGCACTCGTGTGAGACAA
GGCCCATAGGTATGGCCCCCCCCTTCCCCCTCCCAGTACTAGTTAATTTTGAGTAATTGT
ATTGTCAGAAAAGTGATTAGTACTATTTTTTTTTGTTGTTCAAAAAAAAAAAAAXXXXXX
CTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001791 unedited
TTCACCATATTTGTAACACGACTCACTATAGNNGGCGGCCGCGCAATTCGGCACGAGGCC
TCGTGCCGAATTCGGCACGAGGCGCCCCGGTGGAGAAGCTGAGACGGAGTCTCACTGTGT
TGCCCAGGCTGGAGTGCAGTGGCGCCATCTTGGCTCACTGCAGTGCGCCTCTGCCCCCCG
AGTTCAAGCGATTCTCCTGCCTCAGGCTCCTGAGTAGCTGGGACTACAGGTCATCATCAG
ATTTGAAATATTTAAAGTGGATACAAAACTATTTCAGCAATGCAGACAATTAAGTGTGTT
GTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACACAACAAACAAA
TTTCCATCGGAATATGTACCGACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGT
GGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTA
CGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCA
TCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCANAG
ACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAG
AAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGNCTGAAAGCTGGCCCGT
GACCTGAAAGCTGTCAAGTATGTGGAGTGTTCTGCCACTTACACAGAAAAGCCCTAAGAA
TGTTATTTGACGAAAGCATTATGGCCTGCCCCTGGAGCCCTCCAAACCCGAGAAAGACCC
GCAGGTGTGTGCTGCTATTGAACATCTCTACCAAAGCCCCTTTCTGCACAAGCTGGTGGT
CGGCCATCCATACCTAAAGCCATGGTTTTAATTCAAACCTAAGAATTAAAAATCTAAAN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001791 unedited
GACCGCGGGCCGCAATCTAAAGTCGAGTTTTTTTTTTTTTTTTTGAAACAACAAAAAAAA
TAGTACTAATCACTTTTCTGACAATACAATTACTCAAAATTAACTAGTACTGGGAGGGGG
AAGGGGGGGGCCATACCTATGGGCCTTGTCTCACACGAGTGCATGTGGGTAGGTGCAGGG
CATTTGTCATTATTGCAAAAACGAATTTTAATTTTTAATCTTTAGTTTGATTTAAACATT
GCTTTTAGTATGATGCCGACACCAGCTGTGCAGAAAGGGCTCTGGAGAGATGTTCATAGC
AGCACACACCTGCGGCTCTTCTTCGGTTCTGGAGGCTCCAGGGCAGCCAATATTGCTTCG
TCAAATACATTCTTTAGGCCTTTCTGTGTAAGTGCAGAACACTCCACATACTTGACAGCC
TTCAGGTCACGGGCCAGCTTTTCAGCAGTCTCTGGAGTGATAGGCTTCTGTTTGTTCTTG
GCAAGTTTCTCAATAGTAGAGGGGTCATCTCTGAGATCAATTTGAGTCCCAACAAGCAAG
AAAGGAGTCTTTGGACAGTGGTGAGTTATCTCAGGCACCCACTTTTCTTTCACGTTTTCA
AATGAAGATGGAGAGACCACTGAAAAACAGACTAGAAATACATCTGTTTGTGGATAACTC
AGCGGTCGTAATCTGTCATAATCCTCTTGCCCTGCAGTATCAAAAAGTCCAAGAGTATAT
GGGTTCTNCACCAATCATAACTGTGACTGCATAGTTGTCAAAAACAGTCGGTACATATTC
CGATGGAAAATTGTTTGNTGTGTAGGATATCANGAGACATGTTTTACCAACAGCACCATC
GCCCACAACACACACTTAANTGCCTGCATTGCTGAAATAGNTTTGNATCCACTTTAATAT
TCCAATCTGAGATGAACTGTAGTCCAGCACTCNAGAGCTGAGCAGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001791
ORF Size 576 bp
Insert Size 970
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001791.2, NP_001782
RefSeq Size 2183
RefSeq ORF 576
Locus ID 998
Cytogenetics 1p36.12
Domains ras, RAS, RHO, RAB
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, Chemokine signaling pathway, Endocytosis, Axon guidance, VEGF signaling pathway, Focal adhesion, Adherens junction, Tight junction, T cell receptor signaling pathway, Fc gamma R-mediated phagocytosis, Leukocyte transendothelial migration, Neurotrophin signaling pathway, Regulation of actin cytoskeleton, GnRH signaling pathway, Epithelial cell signaling in Helicobacter pylori infection, Pathogenic Escherichia coli infection, Pathways in cancer, Renal cell carcinoma, Pancreatic cancer
Gene Summary The protein encoded by this gene is a small GTPase of the Rho-subfamily, which regulates signaling pathways that control diverse cellular functions including cell morphology, migration, endocytosis and cell cycle progression. This protein is highly similar to Saccharomyces cerevisiae Cdc 42, and is able to complement the yeast cdc42-1 mutant. The product of oncogene Dbl was reported to specifically catalyze the dissociation of GDP from this protein. This protein could regulate actin polymerization through its direct binding to Neural Wiskott-Aldrich syndrome protein (N-WASP), which subsequently activates Arp2/3 complex. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes of this gene have been identified on chromosomes 3, 4, 5, 7, 8 and 20. [provided by RefSeq, Apr 2013]
Transcript Variant: This variant (1) encodes isoform 1 which has the same aa length but different C-terminus from isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.