CDC25C (NM_001790) Human Untagged Clone

CAT#: SC109054

CDC25C (untagged)-Human cell division cycle 25 homolog C (S. pombe) (CDC25C), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CDC25C (NM_001790) Human Untagged Clone
Symbol CDC25C
Synonyms CDC25; PPP1R60
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC109054 sequence for NM_001790 edited (data generated by NextGen Sequencing)
ATGTCTACGGAACTCTTCTCATCCACAAGAGAGGAAGGAAGCTCTGGCTCAGGACCCAGT
TTTAGGTCTAATCAAAGGAAAATGTTAAACCTGCTCCTGGAGAGAGACACTTCCTTTACC
GTCTGTCCAGATGTCCCTAGAACTCCAGTGGGCAAATTTCTTGGTGATTCTGCAAACCTA
AGCATTTTGTCTGGAGGAACCCCAAAACGTTGCCTCGATCTTTCGAATCTTAGCAGTGGG
GAGATAACTGCCACTCAGCTTACCACTTCTGCAGACCTTGATGAAACTGGTCACCTGGAT
TCTTCAGGACTTCAGGAAGTGCATTTAGCTGGGATGAATCATGACCAGCACCTAATGAAA
TGTAGCCCAGCACAGCTTCTTTGTAGCACTCCGAATGGTTTGGACCGTGGCCATAGAAAG
AGAGATGCAATGTGTAGTTCATCTGCAAATAAAGAAAATGACAATGGAAACTTGGTGGAC
AGTGAAATGAAATATTTGGGCAGTCCCATTACTACTGTTCCAAAATTGGATAAAAATCCA
AACCTAGGAGAAGACCAGGCAGAAGAGATTTCAGATGAATTAATGGAGTTTTCCCTGAAA
GATCAAGAAGCAAAGGTGAGCAGAAGTGGCCTATATCGCTCCCCGTCGATGCCAGAGAAC
TTGAACAGGCCAAGACTGAAGCAGGTGGAAAAATTCAAGGACAACACAATACCAGATAAA
GTTAAAAAAAAGTATTTTTCTGGCCAAGGAAAGCTCAGGAAGGGCTTATGTTTAAAGAAG
ACAGTCTCTCTGTGTGACATTACTATCACTCAGATGCTGGAGGAAGATTCTAACCAGGGG
CACCTGATTGGTGATTTTTCCAAGGTATGTGCGCTGCCAACCGTGTCAGGGAAACACCAA
GATCTGAAGTATGTCAACCCAGAAACAGTGGCTGCCTTACTGTCGGGGAAGTTCCAGGGT
CTGATTGAGAAGTTTTATGTCATTGATTGTCGCTATCCATATGAGTATCTGGGAGGACAC
ATCCAGGGAGCCTTAAACTTATATAGTCAGGAAGAACTGTTTAACTTCTTTCTGAAGAAG
CCCATCGTCCCTTTGGACACCCAGAAGAGAATAATCATCGTGTTCCACTGTGAATTCTCC
TCAGAGAGGGGCCCCCGAATGTGCCGCTGTCTGCGTGAAGAGGACAGGTCTCTGAACCAG
TATCCTGCATTGTACTACCCAGAGCTATATATCCTTAAAGGCGGCTACAGAGACTTCTTT
CCAGAATATATGGAACTGTGTGAACCACAGAGCTACTGCCCTATGCATCATCAGGACCAC
AAGACTGAGTTGCTGAGGTGTCGAAGCCAGAGCAAAGTGCAGGAAGGGGAGCGGCAGCTG
CGGGAGCAGATTGCCCTTCTGGTGAAGGACATGAGCCCATGA

Clone variation with respect to NM_001790.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001790 unedited
CCGTCAGAAGTGTATACGACTCATATAGGCGGCCGCGNAATCGGCACGAGGCTTTGGCCT
TCTGCTCAGGGAAGACTCTGAGTCCGACGTTGGCCTACCCAGTCGGAAGGCAGAGCTGCA
ATCTAGTTAACTACCTCCTTTCCCCTAGATTTCCTTTCATTCTGCTCAAGTCTTCGCCTG
TGTCCGATCCCTATCTACTTTCTCTCCTCTTGTAGGCAAGCCTCAGACTCCAGGCTTGAG
CTAGGTTTTGTTTTTCTCCTGGTGAGAATTCGAAGACCATGTCTACGGAACTCTTCTCAT
CCACAAGAGAGGAAGGAAGCTCTGGCTCAGGACCCAGTTTTAGGTCTAATCAAAGGAAAA
TGTTAAACCTGCTCCTGGAGAGAGACACTTCCTTTACCGTCTGTCCAGATGTCCCTAGAA
CTCCAGTGGGCAAATTTCTTGGTGATTCTGCAAACCTAAGCATTTTGTCTGGAGGAACCC
CAAAACGTTGCCTCGATCTTTCGAATCTTAGCAGTGGGGAGATAACTGCCACTCAGCTTA
CCACTTCTGCAGACCTTGATGAAACTGGTCACCTGGATTCTTCAGGACTTCAGGAAGTGC
ATTTAGCTGGGATGAATCATGACCAGCACCTAATGAAATGTAGCCCAGCACAGCTTCTTT
GTAGCACTCCGAATGGTTTGGACCGTGGCCATAGAAAGAGAGATGCAATGTGTAGTTCAT
CTGCAAATAAAGAAAATGACAATGGAAACTTGNTGGACAGTGAAATGAAATATTTGGGCA
GTCCCATTACTACTGNTCCCAAATTGGATAGAAATCCAAACCTAGGAGAAGACCAGGCAG
AAGAGATTTCAGATGAATTATGGGAGTTTTCCCTTGAAGATCAAGAGCCACAGTGAGCCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001790 unedited
TATGGCCGCGGCCGCAATCTAGAGTCGAGTTATTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCAAAAACATCTTTTAATAATCTTGGGGTTG
GCCCTCCAAAAGGCCCCTTTTTGCTCAAGGGTTTTGCAGGGGCTTTTGGGGACTTGTTAA
CAACCCAGGGCTGGAAAGGTATCATGGGCTCATGTCCTTCACCAAAAGGGGAATTTGGTC
CCCCAAGTGGCGGTCCCCTTTCTGGACTTTGGTTTGGGTTCGACACCCCAACAACTCAAT
CTTGGGGGCCCGAAGAAGCATAAGGCAAAAACTCTGGGGGTCACACAGTTCCCTATATTC
TGGAAAAAAATCTCTGTAACCCCCTTTAAAGAAATATAACTCTGGGGAAAACAAAGCAGG
ATACTGGGTCAAAAACCTGTCCTTTTTACCCAAACAGGGGGACATTTGGGGGCCCCTCTC
TGAGGAGAATTCACAGGGGAACACCATGATTATTCTCTTCTGGGGGGCCAAAGGGACCAA
GGGCTTCTTCAAAAAGAAATTAAACAGGTCTTCCTGACTATATAAAGTTAAAGCTCCCTG
GAAGGGGCCCCCCCGAACCCATATGGGTAGCGACCATCAATGACCTAAAACTTTTCAATC
AAACCCTGGAACTTCCCCCACAGTAAAGCAACCCCCTGGTTCTGGGTTGACATACTTCAG
AACTTGGTGTTTCCCTGACACGGTTGGCAGCGCACATACCTTTGAAAAAACACCCATCAA
GTGCCCCTGGTTAAAAACCTCCTCCCACCTCTGAGTGAAAGTATGCCCCCACAGAGACTG
CCTTCTTTAACACTAACCCTTCCTGACCTTCCCTTGGCCAAAAAAAACTTTTTTTTACTT
A
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001790
ORF Size 1422 bp
Insert Size 1860
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001790.2, NP_001781
RefSeq Size 2115
RefSeq ORF 1422
Locus ID 995
Cytogenetics 5q31.2
Domains RHOD
Protein Families Phosphatase, Stem cell - Pluripotency, Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation
Gene Summary This gene encodes a conserved protein that plays a key role in the regulation of cell division. The encoded protein directs dephosphorylation of cyclin B-bound CDC2 and triggers entry into mitosis. It also suppresses p53-induced growth arrest. Multiple alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (1) contains an alternate exon in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate downstream start codon, compared to variant 4. The encoded protein (isoform a) has a distinct and shorter N-terminus than isoform c. Variants 1 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.