RUNX1T1(RUNX1T1) (NM_175635) Human Untagged Clone

CAT#: SC109033

RUNX1T1 (untagged)-Human runt-related transcription factor 1, translocated to, 1 (cyclin D-related) (RUNX1T1), transcript variant 3

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name RUNX1T1(RUNX1T1) (NM_175635) Human Untagged Clone
Symbol RUNX1T1
Synonyms AML1T1; CBFA2T1; CDR; ETO; MTG8; ZMYND2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_175635, the custom clone sequence may differ by one or more nucleotides


ATGCCAGACTCACCTGTGGATGTGAAGACGCAATCTAGGCTGACTCCTCCAACAATGCCACCTCCCCCAA
CTACTCAAGGAGCTCCAAGAACCAGTTCATTTACACCGACAACGTTAACTAATGGCACGAGCCATTCTCC
TACAGCCTTGAATGGCGCCCCCTCACCACCCAATGGCTTCAGCAATGGGCCTTCCTCTTCTTCCTCCTCC
TCTCTGGCTAATCAACAGCTGCCCCCAGCCTGTGGTGCCAGGCAACTCAGCAAGCTGAAAAGGTTCCTTA
CTACCCTGCAGCAGTTTGGCAATGACATTTCACCCGAGATAGGAGAAAGAGTTCGCACCCTCGTTCTGGG
ACTAGTGAACTCCACTTTGACAATTGAAGAATTTCATTCCAAACTGCAAGAAGCTACTAACTTCCCACTG
AGACCTTTTGTCATCCCATTTTTGAAGGCCAACTTGCCCCTGCTGCAGCGTGAGCTCCTCCACTGCGCAA
GACTGGCCAAACAGAACCCTGCCCAGTACCTCGCCCAGCATGAACAGCTGCTTCTGGATGCCAGCACCAC
CTCACCTGTTGACTCCTCAGAGCTGCTTCTCGATGTGAACGAAAACGGGAAGAGGCGAACTCCAGACAGA
ACCAAAGAAAATGGCTTTGACAGAGAGCCTTTGCACTCAGAACATCCAAGCAAGCGACCATGCACTATTA
GCCCAGGCCAGCGGTACAGTCCAAATAACGGCTTATCCTACCAGCCCAATGGCCTGCCTCACCCTACCCC
ACCTCCACCTCAGCATTACCGTTTGGATGATATGGCCATTGCCCACCACTACAGGGACTCCTATCGACAC
CCCAGCCACAGGGACCTCAGGGACAGAAACAGACCTATGGGGTTGCATGGCACACGTCAAGAAGAAATGA
TTGATCACAGACTAACAGACAGAGAATGGGCAGAAGAGTGGAAACATCTTGACCATCTGTTAAACTGCAT
AATGGACATGGTAGAAAAAACAAGGCGATCTCTCACCGTACTAAGGCGGTGTCAAGAAGCAGACCGGGAA
GAATTGAATTACTGGATCCGGCGGTACAGTGACGCCGAGGACTTAAAAAAAGGTGGCGGCAGTAGCAGCA
GCCACTCTAGGCAGCAGAGTCCCGTCAACCCAGACCCAGTTGCACTAGACGCGCATCGGGAATTCCTTCA
CAGGCCTGCGTCTGGATACGTGCCAGAGGAGATCTGGAAGAAAGCTGAGGAGGCCGTCAATGAGGTGAAG
CGCCAGGCGATGACGGAGCTGCAGAAGGCCGTGTCTGAGGCGGAGCGGAAAGCCCACGACATGATCACAA
CAGAGAGGGCCAAGATGGAGCGCACGGTCGCCGAGGCCAAACGGCAGGCGGCGGAGGACGCACTGGCAGT
TATCAATCAGCAGGAGGATTCAAGCGAGAGTTGCTGGAATTGTGGCCGTAAAGCGAGTGAAACCTGCAGT
GGCTGTAACACAGCCCGATACTGTGGCTCATTTTGCCAGCACAAAGACTGGGAGAAGCACCATCACATCT
GTGGACAGACCCTGCAGGCCCAGCAGCAGGGAGACACACCTGCAGTCAGCTCCTCTGTCACGCCCAACAG
CGGGGCTGGGAGCCCGATGGACACACCACCAGCAGCCACTCCGAGGTCAACCACCCCGGGAACCCCTTCC
ACCATAGAGACAACCCCTCGCTAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_175635 unedited
TGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGGAGAAGTGAAGATGTAACA
TGTTATCTGTCGCTCCTCTTAGCTGGCGGAGAGAATTTACATTTAAAGATTAGCAGAGTG
AGAAAGAGAAATCTGCCTTTTGTTGTGTGGGGTGAGGAGGAGGCATCTACCCCTGGCCTT
GACGCTATCTCCCATCACCTCTGCTATCCAGACAGGACTCACCGAGATCGTACTGAGAAG
CACTCCACAATGCCAGACTCACCTGTGGATGTGAAGACGCAATCTAGGCTGACTCCTCCA
ACAATGCCACCTCCCCCAACTACTCAAGGAGCTCCAAGAACCAGTTCATTTACACCGACA
ACGTTAACTAATGGCACGAGCCATTCTCCTACAGCCTTGAATGGCGCCCCCTCACCACCC
AATGGCTTCAGCAATGGGCCTTCCTCTTCTTCCTCCTCCTCTCTGGCTAATCAACAGCTG
CCCCCAGCCTGTGGTGCCAGGCAACTCAGCAAGCTGAAAAGGTTCCTTACTACCCTGCAG
CAGTTTGGCAATGACATTTCACCCGAGATAGGAGAAAGAGTTCGCACCCTCGTTCTGGGA
CTAGTGAACTCCACTTTGACAATTGAAGAATTTCATTCCAAACTGCAAGAAGCTACTAAC
TTCCCACTGAGACCTTNTGTCATCCCATTTTTGAAGGCCAACTTGCCCCTGCTGCAGCGT
GAGCTCCTCCACTGCGCAAGACTGGCCAAACAGAACCCTGCCCAGTACCTCGCCCAGCAT
GAACAGCTGCTTCTGGATGCCAGCACCACCTCACCTGTTGACTNCTCAGAGCTGCTTCTC
GATGTGAACGAAAACGGGAAGAGGCGAACTCCAGACAGACCC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_175635
ORF Size 1704 bp
Insert Size 3000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_175635.1, NP_783553
RefSeq Size 3233
RefSeq ORF 1704
Locus ID 862
Cytogenetics 8q21.3
Protein Families Transcription Factors
Protein Pathways Pathways in cancer, Acute myeloid leukemia
Gene Summary This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (3) utilizes an alternate exon in the 5' UTR and coding region compared to variant 1, resulting in translation initiation from a downstream ATG. The resulting protein (isoform C, also known as MTG8c) has a shorter N-terminus compared to isoform A. Variants 3 and 4 both encode isoform C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.