Caspase 10(CASP10) (NM_001230) Human Untagged Clone

CAT#: SC109030

CASP10 (untagged)-Human caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 3

USD 763


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Caspase 10(CASP10) (NM_001230) Human Untagged Clone
Symbol CASP10
Synonyms ALPS2; FLICE2; MCH4
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001230, the custom clone sequence may differ by one or more nucleotides


ATGAAATCTCAAGGTCAACATTGGTATTCCAGTTCAGATAAAAACTGTAAAGTGAGCTTTCGTGAGAAGC
TTCTGATTATTGATTCAAACCTGGGGGTCCAAGATGTGGAGAACCTCAAGTTTCTCTGCATAGGATTGGT
CCCCAACAAGAAGCTGGAGAAGTCCAGCTCAGCCTCAGATGTTTTTGAACATCTCTTGGCAGAGGATCTG
CTGAGTGAGGAAGACCCTTTCTTCCTGGCAGAACTCCTCTATATCATACGGCAGAAGAAGCTGCTGCAGC
ACCTCAACTGTACCAAAGAGGAAGTGGAGCGACTGCTGCCCACCCGACAAAGGGTTTCTCTGTTTAGAAA
CCTGCTCTACGAACTGTCAGAAGGCATTGACTCAGAGAACTTAAAGGACATGATCTTCCTTCTGAAAGAC
TCGCTTCCCAAAACTGAAATGACCTCCCTAAGTTTCCTGGCATTTCTAGAGAAACAAGGTAAAATAGATG
AAGATAATCTGACATGCCTGGAGGACCTCTGCAAAACAGTTGTACCTAAACTTTTGAGAAACATAGAGAA
ATACAAAAGAGAGAAAGCTATCCAGATAGTGACACCTCCTGTAGACAAGGAAGCCGAGTCGTATCAAGGA
GAGGAAGAACTAGTTTCCCAAACAGATGTTAAGACATTCTTGGAAGCCTTACCGAGGGCAGCTGTGTACA
GGATGAATCGGAACCACAGAGGCCTCTGTGTCATTGTCAACAACCACAGCTTTACCTCCCTGAAGGACAG
ACAAGGAACCCATAAAGATGCTGAGATCCTGAGTCATGTGTTCCAGTGGCTTGGGTTCACAGTGCATATA
CACAATAATGTGACGAAAGTGGAAATGGAGATGGTCCTGCAGAAGCAGAAGTGCAATCCAGCCCATGCCG
ACGGGGACTGCTTCGTGTTCTGTATTCTGACCCATGGGAGATTTGGAGCTGTCTACTCTTCGGATGAGGC
CCTCATTCCCATTCGGGAGATCATGTCTCACTTCACAGCCCTGCAGTGCCCTAGACTGGCTGAAAAACCT
AAACTCTTTTTCATCCAGGCCTGCCAAGGTGAAGAGATACAGCCTTCCGTATCCATCGAAGCAGATGCTC
TGAACCCTGAGCAGGCACCCACTTCCCTGCAGGACAGTATTCCTGCCGAGGCTGACTTCCTACTTGGTCT
GGCCACTGTCCCAGGCTATGTATCCTTTCGGCATGTGGAGGAAGGCAGCTGGTATATTCAGTCTCTGTGT
AATCATCTGAAGAAATTGGTCCCAAGACATGAAGACATCTTATCCATCCTCACTGCTGTCAACGATGATG
TGAGTCGAAGAGTGGACAAACAGGGAACAAAGAAACAGATGCCCCAGCCTGCTTTCACACTAAGGAAAAA
ACTAGTATTCCCTGTGCCCCTGGATGCACTTTCATTATAG


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001230
ORF Size 1440 bp
Insert Size 4110
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001230.4, NP_001221
RefSeq Size 5777
RefSeq ORF 1440
Locus ID 843
Cytogenetics 2q33.1
Domains Peptidase_C14, DED, CASc
Protein Families Protease, Druggable Genome
Protein Pathways Apoptosis, RIG-I-like receptor signaling pathway
Gene Summary This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (3) lacks two in-frame coding exons compared to variant 1. This results in a shorter isoform (3, also known as Mch4 and caspase-10/a) missing an internal protein segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.