BMP4 (NM_001202) Human Untagged Clone

CAT#: SC108985

Reviews ()
Write a review

BMP4 (untagged)-Human bone morphogenetic protein 4 (BMP4), transcript variant 1



  "NM_001202" in other vectors (6)

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name BMP4 (NM_001202) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol BMP4
Synonyms BMP2B; BMP2B1; MCOPS6; OFC11; ZYME
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_001202 edited
GAATTCGGCACCAGGCTAGGTGAGTGTGGCATCCGAGCTGAGGGACGCGAGCCTGAGACG
CCGCTGCTGCTCCGGCTGAGTATCTAGCTTGTCTCCCCGATGGGATTCCCGTCCAAGCTA
TCTCGAGCCTGCAGCGCCACAGTCCCCGGCCCTCGCCCAGGTTCACTGCAACCGTTCAGA
GGTCCCCAGGAGCTGCTGCTGGCGAGCCCGCTACTGCAGGGACCTATGGAGCCATTCCGT
AGTGCCATCCCGAGCAACGCACTGCTGCAGCTTCCCTGAGCCTTTCCAGCAAGTTTGTTC
AAGATTGGCTGTCAAGAATCATGGACTGTTATTATATGCCTTGTTTTCTGTCAAGACACC
ATGATTCCTGGTAACCGAATGCTGATGGTCGTTTTATTATGCCAAGTCCTGCTAGGAGGC
GCGAGCCATGCTAGTTTGATACCTGAGACGGGGAAGAAAAAAGTCGCCGAGATTCAGGGC
CACGCGGGAGGACGCCGCTCAGGGCAGAGCCATGAGCTCCTGCGGGACTTCGAGGCGACA
CTTCTGCAGATGTTTGGGCTGCGCCGCCGCCCGCAGCCTAGCAAGAGTGCCGTCATTCCG
GACTACATGCGGGATCTTTACCGGCTTCAGTCTGGGGAGGAGGAGGAAGAGCAGATCCAC
AGCACTGGTCTTGAGTATCCTGAGCGCCCGGCCAGCCGGGCCAACACCGTGAGGAGCTTC
CACCACGAAGAACATCTGGAGAACATCCCAGGGACCAGTGAAAACTCTGCTTTTCGTTTC
CTCTTTAACCTCAGCAGCATCCCTGAGAACGAGGTGATCTCCTCTGCAGAGCTTCGGCTC
TTCCGGGAGCAGGTGGACCAGGGCCCTGATTGGGAAAGGGGCTTCCACCGTATAAACATT
TATGAGGTTATGAAGCCCCCAGCAGAAGTGGTGCCTGGGCACCTCATCACACGACTACTG
GACACGAGACTGGTCCACCACAATGTGACACGGTGGGAAACTTTTGATGTGAGCCCTGCG
GTCCTTCGCTGGACCCGGGAGAAGCAGCCAAACTATGGGCTAGCCATTGAGGTGACTCAC
CTCCATCAGACTCGGACCCACCAGGGCCAGCATGTCAGGATTAGCCGATCGTTACCTCAA
GGGAGTGGGAATTGGGCCCAGCTCCGGCCCCTCCTGGTCACCTTTGGCCATGATGGCCGG
GGCCATGCCTTGACCCGACGCCGGAGGGCCAAGCGTAGCCCTAAGCATCACTCACAGCGG
GCCAGGAAGAAGAATAAGAACTGCCGGCGCCACTCGCTCTATGTGGACTTCAGCGATGTG
GGCTGGAATGACTGGATTGTGGCCCCACCAGGCTACCAGGCCTTCTACTGCCATGGGGAC
TGCCCCTTTCCACTGGCTGACCACCTCAACTCAACCAACCATGCCATTGTGCAGACCCTG
GTCAATTCTGTCAATTCCAGTATCCCCAAAGCCTGTTGTGTGCCCACTGAACTGAGTGCC
ATCTCCATGCTGTACCTGGATGAGTATGATAAGGTGGTACTGAAAAATTATCAGGAGATG
GTAGTAGAGGGATGTGGGTGCCGCTGAGATCAGGCAGTCCTTGAGGATAGACAGATATAC
ACACCACACACACACACCACATACACCACACACACACGTTCCCATCCACTCACCCACACA
CTACACAGACTGCTTCCTTATAGCTGGACTTTTATTTAAAAAAAAAAAAAAAAAACTCGA
C
>OriGene 5' read for NM_001202 unedited
TATTTTGTAATACGACTCACTATAGGGCGGCNCGCGAATTCGCACCAGGCTAGGTGAGTG
TGGCATCCGAGCTGAGGGACGCGAGCCTGAGACGCCGCTGCTGCTCCGGCTGAGTATCTA
GCTTGTCTCCCCGATGGGATTCCCGTCCAAGCTATCTCGAGCCTGCAGCGCCACAGTCCC
CGGCCCTCGCCCAGGTTCACTGCAACCGTTCAGAGGTCCCCAGGAGCTGCTGCTGGCGAG
CCCGCTACTGCAGGGACCTATGGAGCCATTCCGTAGTGCCATCCCGAGCAACGCACTGCT
GCAGCTTCCCTGAGCCTTTCCAGCAAGTTTGTTCAAGATTGGCTGTCAAGAATCATGGAC
TGTTATTATATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGAT
GGTCGTTTTATTATGCCAAGTCCTGCTAGGAGGCGCGAGCCATGCTAGTTTGATACCTGA
GACGGGGAAGAAAAAAGTCGCCGAGATTCAGGGCCACGCGGGAGGACGCCGCTCAGGGCA
GAGCCATGAGCTCCTGCGGGACTTCGAGGCGACACTTCTGCAGATGTTTGGGCTGCGCCG
CCGCCCGCAGCCTAGCAAGAGTGCCGTCATTCCGGACTACATGCGGGATCTTTACCGGCT
TCAGTCTGGGGAGGAGGAGGAAGAGCAGATCCACAGCACTGGTCTTGAGTATCCTGAGCG
CCCGGCCAGCCCGGCCAACACCGTGAGGAGCTTCCACCACGAAGAACATCTGGAGAACAT
CCCAGGNACCAGTGAAACTCTGCTTTTCCGTTCCTCTTTACCTCACAGCATCCCTGAAAC
GAGTGATCTCTCTGCAAACTTGGCTCTTCCGGACAGTGGCCAGGCCCTGATTGGAAGGGC
TCCACGTATAACATTATGAGTTGAGCCCCACAAATGTGCTGGCCCTATAACGC
>OriGene 3' read for NM_001202 unedited
CCAGAACTACGNCACGCAATCTAAATACAAATTCTCTTCTCTCTCTCTCTTTAAATAAAA
CTNCACCTATAAAGAAGCACTCTCACTACAGACAAACAAACAAGATAAAAACCTCTGACA
GAAGAGTAAGAAGACAGAGAGAGAAGAGNNNATATCAGCCTATCCTCAAGGACTGCCTGA
TCTCANCGGCACCCACATCCCTCTACTACCACCCCCCCACAACTCCCCACCACCACCCTA
TCACACCCATCCAGGTCCACCGNGGACACCGCACCCANNCCACCGCCCCCACAACCGCCC
CCCCCCCACCCGGCACCCCACCCCCCCCCCACCCCACCCCCCCCAACCCCCCCCCCCCCC
CCCCGTCCCCCAACCCCCCCCCCCCCCCCCCCCACCCCCCACACCCCCCCCCACCCAGAA
CCCCCCCACCACCAACCACACCCCCCCCCCCCCCCCCACCCCCCCACCCCCCACCACCCC
CCACACCACTCCCCACACCACCCACCCACCACACCCCCCCCTTCCACCCCCACCCCACTA
CCCTCCCCCCCCCCCCCACCCCACCCCCCCCCCCTTAATAACCGTTCCACCCCAACACCC
CACCACCCCCCCCCCGCTCACACCAACCCCCCCACCCCACCCCCCCCCCCCCTTTTTCCC
ACCCACACCCACCCCCCCACCACCCCCACCCCCCCCCCCCCCCCCCCCCCCCACCACCCC
CCCCCCCCCCTCCCCCCCCACCCCCCACCACCCCCCCCACAACACCACACCACCCACGCC
CCTACACCCCCCCCCCTACACCCCCCCCCCCCCCCCCCACCCACACCCCCCACACCCCCC
ACCCACCCCCTACCCCCCACCCCCACCCCGCTCCCCTCCCCCACCCCCCCCCAATAACAC
AAACACACACCCACCACCCCCACCA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001202
Insert Size 1730 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001202.2, NP_001193.1
RefSeq Size 1999 bp
RefSeq ORF 1227 bp
Locus ID 652
Cytogenetics 14q22.2
Domains TGFb_propeptide, TGF-beta
Protein Families Adult stem cells, Cancer stem cells, Druggable Genome, Embryonic stem cells, Induced pluripotent stem cells, Secreted Protein, Stem cell relevant signaling - TGFb/BMP signaling pathway
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Pathways in cancer, TGF-beta signaling pathway
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (1) uses the P1 promoter and encodes isoform a.

Other Versions

Other products for "BMP4"
Frequently bought together (2)
Anti-BMP4 mouse monoclonal antibody, clone OTI6B7 (formerly 6B7)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools