BID (NM_197967) Human Untagged Clone

CAT#: SC108979

BID (untagged)-Human BH3 interacting domain death agonist (BID), transcript variant 3

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BID (NM_197967) Human Untagged Clone
Symbol BID
Synonyms FP497
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC108979 sequence for NM_197967 edited (data generated by NextGen Sequencing)
ATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTGCAGCTCAGGAACACC
AGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTGGAGCAGCTGCTGCAG
GCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTGGCCCTGCTGCTGGCC
AAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTTCACACAACAGTGAAC
TTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGAAATGGGATGGACTGA

Clone variation with respect to NM_197967.2
240 t=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_197967 unedited
AATTTGTATACGACTCCTATAGGCGGCCGCGAATTCGGCACGAGGAACGGTTCCAGCCTC
AGGGATGAGTGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAAC
AGCTTCCGCAGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGG
GAGGGCTACGATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGA
ATAGAGGCAGATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACCTCGCC
CAGGTCGGGGACAGCATGGACCGTACCATCCCTCCGGGCCTGGTGAACGGCCTGGCCCTG
CAGCTCAGGAACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTGCCCTG
GAGCAGCTGCTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGGTGCTG
GCCCTGCTGCTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATGTCTTT
CACACAACAGTGAACTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAGCCAGA
AATGGGATGGACTGAACGGACAGTTCCAGAAGTGCGACTGGCTAAAGCTCGATGTGGTCA
CAGCTGTATAGCTGCTTCCAGTGTAGACGGAGCCCTGGCATGTCAACAGCGTTCCTAGAG
AAGACCAGCCTGGAAGATAGCTGTGACTTCTATTTTAAAGACCATGCTCAACTTAAACCC
CACTTTCAAATATCCACATTAATATACTTGAATGACAATGTCCATTTACACGTATTTGAA
TGGCCTTCATATCATCCCCACATGAATCTGCCCTCTTG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_197967
ORF Size 300 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_197967.1, NP_932071
RefSeq Size 2144
RefSeq ORF 300
Locus ID 637
Cytogenetics 22q11.21
Protein Families Druggable Genome
Protein Pathways p53 signaling pathway, Apoptosis, Natural killer cell mediated cytotoxicity, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Pathways in cancer, Viral myocarditis
Gene Summary This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' region and uses a downstream start codon, as compared to variant 1. It encodes isoform 3 which has a shorter N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.