ATM (NM_138292) Human Untagged Clone

CAT#: SC108961

ATM (untagged)-Human ataxia telangiectasia mutated (ATM), transcript variant 2

USD 2,658.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ATM (NM_138292) Human Untagged Clone
Symbol ATM
Synonyms AT1; ATA; ATC; ATD; ATDC; ATE; DKFZp781A0353; MGC74674; TEL1; TELO1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC108961 sequence for NM_138292 edited (data generated by NextGen Sequencing)
ATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGACTTT
TCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGATTAAAGCA
ACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTT
TCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAA
ACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTA
TTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTT
ATTTATACTTTGATTCACTATATCAACCAAAGGCCTTCTTGTATCATGGATGTGTCATTA
CGTAGCTTCTCCCTTTGTTGTGACTTATTAAGTCAGGTTTGCCAGACAGCCGTGACTTAC
TGTAAGGATGCTCTAGAAAACCATCTTCATGTTATTGTTGGTACACTTATACCCCTTGTG
TATGAGCAGGTGGAGGTTCAGAAACAGGTATTGGACTTGTTGAAATACTTAGTGATAGAT
AACAAGGATAATGAAAACCTCTATATCACGATTAAGCTTTTAGATCCTTTTCCTGACCAT
GTTGTTTTTAAGGATTTGCGTATTACTCAGCAAAAAATCAAATACAGTAGAGGACCCTTT
TCACTCTTGGAGGAAATTAACCATTTTCTCTCAGTAAGTGTTTATGATGCACTTCCATTG
ACAAGACTTGAAGGACTAAAGGATCTTCGAAGACAACTGGAACTACATAAAGATCAGATG
GTGGACATTATGAGAGCTTCTCAGGATAATCCGCAAGATGGGATTATGGTGAAACTAGTT
GTCAATTTGTTGCAGTTATCCAAGATGGCAATAAACCACACTGGTGAAAAAGAAGTTCTA
GAGGCTGTTGGAAGCTGCTTGGGAGAAGTGGGTCCTATAGATTTCTCTACCATAGCTATA
CAACATAGTAAAGATGCATCTTATACCAAGGCCCTTAAGTTATTTGAAGATAAAGAACTT
CAGTGGACCTTCATAATGCTGACCTACCTGAATAACACACTGGTAGAAGATTGTGTCAAA
GTTCGATCAGCAGCTGTTACCTGTTTGAAAAACATTTTAGCCACAAAGACTGGACATAGT
TTCTGGGAGATTTATAAGATGACAACAGATCCAATGCTGGCCTATCTACAGCCTTTTAGA
ACATCAAGAAAAAAGTTTTTAGAAGTACCCAGATTTGACAAAGAAAACCCTTTTGAAGGC
CTGGATGATATAAATCTGTGGATTCCTCTAAGTGAAAATCATGACATTTGGATAAAGACA
CTGACTTGTGCTTTTTTGGACAGTGGAGGCACAAAATGTGAAATTCTTCAATTATTAAAG
CCAATGTGTGAAGTGAAAACTGACTTTTGTCAGACTGTACTTCCATACTTGATTCATGAT
ATTTTACTCCAAGATACAAATGAATCATGGAGAAATCTGCTTTCTACACATGTTCAGGGA
TTTTTCACCAGCTGTCTTCGACACTTCTCGCAAACGAGCCGATCCACAACCCCTGCAAAC
TTGGATTCAGAGTCAGAGCACTTTTTCCGATGCTGTTTGGATAAAAAATCACAAAGAACA
ATGCTTGCTGTTGTGGACTACATGAGAAGACAAAAGAGACCTTCTTCAGGAACAATTTTT
AATGATGCTTTCTGGCTGGATTTAAATTATCTAGAAGTTGCCAAGGTAGCTCAGTCTTGT
GCTGCTCACTTTACAGCTTTACTCTATGCAGAAATCTATGCAGATAAGAAAAGTATGGAT
GATCAAGAGAAAAGAAGTCTTGCATTTGAAGAAGGAAGCCAGAGTACAACTATTTCTAGC
TTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGTTTACAGGATCTTCTCTTAGAAATC
TACAGAAGTATAGGGGAGCCAGATAGTTTGTATGGCTGTGGTGGAGGGAAGATGTTACAA
CCCATTACTAGACTACGAACATATGAACACGAAGCAATGTGGGGCAAAGCCCTAGTAACA
TATGACCTCGAAACAGCAATCCCCTCATCAACACGCCAGGCAGGAATCATTCAGGCCTTG
CAGAATTTGGGACTCTGCCATATTCTTTCCGTCTATTTAAAAGGATTGGATTATGAAAAT
AAAGACTGGTGTCCTGAACTAGAAGAACTTCATTACCAAGCAGCATGGAGGAATATGCAG
TGGGACCATTGCACTTCCGTCAGCAAAGAAGTAGAAGGAACCAGTTACCATGAATCATTG
TACAATGCTCTACAATCTCTAAGAGACAGAGAATTCTCTACATTTTATGAAAGTCTCAAA
TATGCCAGAGTAAAAGAAGTGGAAGAGATGTGTAAGCGCAGCCTTGAGTCTGTGTATTCG
CTCTATCCCACACTTAGCAGGTTGCAGGCCATTGGAGAGCTGGAAAGCATTGGGGAGCTT
TTCTCAAGATCAGTCACACATAGACAACTCTCTGAAGTATATATTAAGTGGCAGAAACAC
TCCCAGCTTCTCAAGGACAGTGATTTTAGTTTTCAGGAGCCTATCATGGCTCTACGCACA
GTCATTTTGGAGATCCTGATGGAAAAGGAAATGGACAACTCACAAAGAGAATGTATTAAG
GACATTCTCACCAAACACCTTGTAGAACTCTCTATACTGGCCAGAACTTTCAAGAACACT
CAGCTCCCTGAAAGGGCAATATTTCAAATTAAACAGTACAATTCAGTTAGCTGTGGAGTC
TCTGAGTGGCAGCTGGAAGAAGCACAAGTATTCTGGGCAAAAAAGGAGCAGAGTCTTGCC
CTGAGTATTCTCAAGCAAATGATCAAGAAGTTGGATGCCAGCTGTGCAGCGAACAATCCC
AGCCTAAAACTTACATACACAGAATGTCTGAGGGTTTGTGGCAACTGGTTAGCAGAAACG
TGCTTAGAAAATCCTGCGGTCATCATGCAGACCTATCTAGAAAAGGCAGTAGAAGTTGCT
GGAAATTATGATGGAGAAAGTAGTGATGAGCTAAGAAATGGAAAAATGAAGGCATTTCTC
TCATTAGCCCGGTTTTCAGATACTCAATACCAAAGAATTGAAAACTACATGAAATCATCG
GAATTTGAAAACAAGCAAGCTCTCCTGAAAAGAGCCAAAGAGGAAGTAGGTCTCCTTAGG
GAACATAAAATTCAGACAAACAGATACACAGTAAAGGTTCAGCGAGAGCTGGAGTTGGAT
GAATTAGCCCTGCGTGCACTGAAAGAGGATCGTAAACGCTTCTTATGTAAAGCAGTTGAA
AATTATATCAACTGCTTATTAAGTGGAGAAGAACATGATATGTGGGTATTCCGACTTTGT
TCCCTCTGGCTTGAAAATTCTGGAGTTTCTGAAGTCAATGGCATGATGAAGAGAGACGGA
ATGAAGATTCCAACATATAAATTTTTGCCTCTTATGTACCAATTGGCTGCTAGAATGGGG
ACCAAGATGATGGGAGGCCTAGGATTTCATGAAGTCCTCAATAATCTAATCTCTAGAATT
TCAATGGATCACCCCCATCACACTTTGTTTATTATACTGGCCTTAGCAAATGCAAACAGA
GATGAATTTCTGACTAAACCAGAGGTAGCCAGAAGAAGCAGAATAACTAAAAATGTGCCT
AAACAAAGCTCTCAGCTTGATGAGGATCGAACAGAGGCTGCAAATAGAATAATATGTACT
ATCAGAAGTAGGAGACCTCAGATGGTCAGAAGTGTTGAGGCACTTTGTGATGCTTATATT
ATATTAGCAAACTTAGATGCCACTCAGTGGAAGACTCAGAGAAAAGGCATAAATATTCCA
GCAGACCAGCCAATTACTAAACTTAAGAATTTAGAAGATGTTGTTGTCCCTACTATGGAA
ATTAAGGTGGACCACACAGGAGAATATGGAAATCTGGTGACTATACAGTCATTTAAAGCA
GAATTTCGCTTAGCAGGAGGTGTAAATTTACCAAAAATAATAGATTGTGTAGGTTCCGAT
GGCAAGGAGAGGAGACAGCTTGTTAAGGGCCGTGATGACCTGAGACAAGATGCTGTCATG
CAACAGGTCTTCCAGATGTGTAATACATTACTGCAGAGAAACACGGAAACTAGGAAGAGG
AAATTAACTATCTGTACTTATAAGGTGGTTCCCCTCTCTCAGCGAAGTGGTGTTCTTGAA
TGGTGCACAGGAACTGTCCCCATTGGTGAATTTCTTGTTAACAATGAAGATGGTGCTCAT
AAAAGATACAGGCCAAATGATTTCAGTGCCTTTCAGTGCCAAAAGAAAATGATGGAGGTG
CAAAAAAAGTCTTTTGAAGAGAAATATGAAGTCTTCATGGATGTTTGCCAAAATTTTCAA
CCAGTTTTCCGTTACTTCTGCATGGAAAAATTCTTGGATCCAGCTATTTGGTTTGAGAAG
CGATTGGCTTATACGCGCAGTGTAGCTACTTCTTCTATTGTTGGTTACATACTTGGACTT
GGTGATAGACATGTACAGAATATCTTGATAAATGAGCAGTCAGCAGAACTTGTACATATA
GATCTAGGTGTTGCTTTTGAACAGGGCAAAATCCTTCCTACTCCTGAGACAGTTCCTTTT
AGACTCACCAGAGATATTGTGGATGGCATGGGCATTACGGGTGTTGAAGGTGTCTTCAGA
AGATGCTGTGAGAAAACCATGGAAGTGATGAGAAACTCTCAGGAAACTCTGTTAACCATT
GTAGAGGTCCTTCTATATGATCCACTCTTTGACTGGACCATGAATCCTTTGAAAGCTTTG
TATTTACAGCAGAGGCCGGAAGATGAAACTGAGCTTCACCCTACTCTGAATGCAGATGAC
CAAGAATGCAAACGAAATCTCAGTGATATTGACCAGAGTTTCAACAAAGTAGCTGAACGT
GTCTTAATGAGACTACAAGAGAAACTGAAAGGAGTGGAAGAAGGCACTGTGCTCAGTGTT
GGTGGACAAGTGAATTTGCTCATACAGCAGGCCATAGACCCCAAAAATCTCAGCCGACTT
TTCCCAGGATGGAAAGCTTGGGTGTGA

Clone variation with respect to NM_138292.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_138292 unedited
AAAGAGAATGGATTAGAACCTCACCTTGTGAAAAAGGTTTTAGAGAAAGTTTCTGAAACT
TTTGGATATAGACGTTTAGAAGACTTTATGGCATCTCATTTAGATTATCTGGTTTTGGAA
TGGCTAAATCTTCAAGATACTGAATACAACTTATCTTCTTTTCCTTTTATTTTATTAAAC
TACACAAATATTGAGGATTTCTATAGATCTTGTTATAAGGTTTTGATTCCACATCTGGTG
ATTAGAAGTCATTTTGATGAGGTGAAGTCCATTGCTAATCAGATTCAAGAGGACTGGAAA
AGTCTTCTAACAGACTGCTTTCCAAAGATTCTTGTAAATATTCTTCCTTATTTTGCCTAT
GAGGGTACCAGAGACAGTGGGATGGCACAGCAAAGAGAGACTGCTACCAAGGTCTATGAT
ATGCTTAAAAGTGAAAACTTATTGGGAAAACAGATTGATCACTTATTCATTAGTAATTTA
CCAGAGATTGTGGTGGAGTTATTGATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGT
CAGAGCACTGACCTCTGTGACTTTTCAGGGGATNTTGGATCCTGCTCCTAATCCACCTCA
TTTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAA
GNTAAAAAGCATTNTAGAAATTCTTTCCCAAAGCCCTGATTCCTATCAGAAAATTCTTCT
TGCCATATGTGAGCAAGCAGCTGAACCAATTATGTTTATAGGAAGCACAGAATTCTTAAT
ATATCACCTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_138292 unedited
CTATGGAACCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTTTGAGATGGA
GTTTCGCTCTTGTCACCCAGGCTGGAGTGCAATGGCATGATTTTGGCCCACAGCAACCTT
CACCTCCCAGGTTCAAGAGATTCTCCTGCCTCAGCCTCTCGAGTAGCTGGGACCACAGGT
GCCCGCCACCATGCTCGGCTAATTTTTGTATTCTTAGTAGAGACAGGGTTTCACCATACT
GGCCAGGCTGGTCTCTTGGCCAGGCTGGTCTCGAACTCCTGACCTCGTGATCCGCTCACC
TCGGCCTCCCAAAGTGCTGGGACTACAGGCGTGAGCCGCCGCGCCCAGCCCGAATGACCA
TTATTTCTAAAGAGTGAAAGCAGAGATGTTCCTTAAGACCATCAAAACATTTTTGAGTGG
TGATTAAATCAAGTATTAAAACCAACATTCAAAAAAACCCACAATAGTTCACTTAAATAT
TAATCCCTACTTAAAGTATGTTGGCAGGTTAAAAATAAAGGCTAAAATATAATTTCTAAA
GGCTGAATGAAAGGGTAATTCATATACTGAAGATCACACCCAAGCTTTCCATCCTGGGAA
AAGTCGGCTGAGATTTTTGGGGTCTATGGCCTGCTGTATGAGCAAATTCACTTGTCCACC
AACACTGAGCACAGTGCCTTCTTCCACTCCTTTCAGTTTCTCTTGTAGTCTCATTAAGAC
ACGTTCAGCTACTTTGTTGAAACTCTGGTCAATATCACTGAGATTTTCGTTGCATTCTTG
GTCATCTGCATTCAGAGTAGGGTGAAGCTCAGTTTCATCCTCCGGCCTCTGCTGAAATAC
AAAGCTTTCAAAGGATCATTGTTCCATCCAAGAGTGGATCATATAGAAGGACCTCTCCAT
GGTAACAGAGTTTCTGAGAGTTTCTCATCCTTCCTGGTTTTCTCCAGCCACTTTGAAGAC
ACTTCACAACCGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_138292
ORF Size 5127 bp
Insert Size 6000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_138292.3, NP_612149
RefSeq Size 8977
Locus ID 472
Cytogenetics 11q22.3
Domains PI3_PI4_kinase, FAT, FATC
Protein Families Protein Kinase, Transcription Factors, Druggable Genome
Protein Pathways Cell cycle, p53 signaling pathway, Apoptosis
Gene Summary The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010].
Transcript Variant: This variant (2) contains a distinct 5' UTR and is missing part of the 5' end of the coding region when compared to variant 1. The resulting isoform (2) has a truncated N-terminus when compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.