Aspartate beta hydroxylase (ASPH) (NM_032467) Human Untagged Clone

CAT#: SC108956

ASPH (untagged)-Human aspartate beta-hydroxylase (ASPH), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ASPH
• Synonyms: AAH; BAH; CASQ2BP1; FDLAB; HAAH; JCTN; junctin
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032467, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGAAGATAAAGAGACAAAGCATGGAGGACACAAGAATGGGAGGAAAGGCGGACTCTCAGGAACTT
  CATTCTTCACGTGGTTTATGGTGATTGCATTGCTGGGCGTCTGGACATCTGTAGCTGTCGTTTGGTTTGA
  TCTTGTTGACTATGAGGAAGTTCTAGGAAAACTAGGAATCTATGATGCTGATGGTGATGGAGATTTTGAT
  GTGGATGATGCCAAAGTTTTATTAGAAGGACCCAGTGGGGTAGCCAAGAGAAAAACTAAGGCTAAAGTTA
  AAGAACTCACTAAAGAAGAGCTCAAGAAGGAGAAAGAGAAACCTGAGTCAAGGAAGGAAAGTAAGAATGA
  AGAGAGAAAAAAGGGGAAGAAAGAGGATGTCCGAAAGGATAAGAAAATTGCTGATGCAGACCTATCCAGG
  AAGGAGTCTCCTAAGGGTAAAAAGGACAGAGAAAAAGAGAAAGTGGACCTAGAAAAAAGTGCTAAAACCA
  AGGAAAATAGGAAAAAATCAACAAATATGAAGGATGTTTCTAGTAAAATGGCATCCCGAGACAAAGATGA
  CAGAAAGGAAAGTAGAAGTTCTACCAGATATGCACACTTAACAAAGGGAAATACCCAGAAAAGAAACGGC
  TAA
  
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_032467 unedited
  NAGGGGTTTTCACCATTTATGTATACGACTCATATAGGCGGCCGCGAAATTCGCACGAGG
  GATTGGCCAGTCTCAAGCTCTGGTAGGCAAGTGCATGCAGTGTGCCTAAAACCTGCCAGC
  AGTACTTTTGAGTTTTTTTTTTTTGTTTTGTTTTACTTTAGCATTTATTATTCATGGATT
  GAAGAAATCAAAATGGCTGAAGATAAAGAGACAAAGCATGGAGGACACAAGAATGGGAGG
  AAAGGCGGACTCTCAGGAACTTCATTCTTCACGTGGTTTATGGTGATTGCATTGCTGGGC
  GTCTGGACATCTGTAGCTGTCGTTTGGTTTGATCTTGTTGACTATGAGGAAGTTCTAGGA
  AAACTAGGAATCTATGATGCTGATGGTGATGGAGATTTTGATGTGGATGATGCCAAAGTT
  TTATTAGGACTTAAAGAGAGATCTACTTCAGAGCCAGCAGTCCCGCCAGAAGAGGCTGAG
  CCACACACTGAGCCCGAGGAGCAGGTTCCTGTGGAGGCAGAACCCCAGAATATCGAAGAT
  GAAGCAAAAGAACAAATTCAGTCCCTTCTTCATGAAATGGTACACGCAGAACATGTTGAG
  GGAGAAGACTTGCAACAAGAAGATGGACCCACAGGAGAACCACAACAAGAGGATGATGAG
  GTTCTTATGGCGACTGATGTAGATGATAGATTTGAGACCCTGGAACCTGAAATATCTCAT
  GAAAGAACCGCACATATTTACCACGTTGGAAGAGACAGTTTCACAAGACTGTTATCAAGA
  TATGGAAGAGATGATGTCTTAGCCAGAACATCCAGATTCCAGTGAACCACTATATAAGAT
  GAAAGATTGCCCCTGATACAAATGATGTCACTTACCCAAGCTATGAGGACAAACCCTTTT
  TTGAACCTCTTACAAATGAA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_032467
• Insert Size: 2740 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_032467.1, NP_115856.1
• RefSeq Size: 3242 bp
• RefSeq ORF: 633 bp
• Locus ID: 444
• UniProt ID: Q12797
• Cytogenetics: 8q12.3
• Domains: Asp-B-Hydro_N
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
  Transcript Variant: This variant (4) represents use of an alternate promoter and 5' UTR, uses a distinct start codon, and uses a distinct 3' splice pattern that lacks many coding exons, compared to variant 1. The encoded isoform (d) has a slightly shorter and distinct N-terminus and some overlap with the N-terminus of isoform a, but lacks the catalytic domain and enzymatic function of isoform a. This isoform has also been referred to as junctin and forms a complex with calsequestrin, triadin, and the ryanodine receptor by direct interaction at the C-terminal part of the molecule. This protein appears to stabilize the complex and plays a crucial role in the regulation of calcium release from the sarcoplasmic reticulum. This variant is expressed in cardiac and skeletal muscle. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.