Angiotensin II Type 1 Receptor(AGTR1) (NM_000685) Human Untagged Clone

CAT#: SC108918

AGTR1 (untagged)-Human angiotensin II receptor, type 1 (AGTR1), transcript variant 1

USD 505


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Angiotensin II Type 1 Receptor(AGTR1) (NM_000685) Human Untagged Clone
Symbol AGTR1
Synonyms AG2S; AGTR1B; AT1; AT1AR; AT1B; AT1BR; AT1R; AT2R1; HAT1R
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000685 edited
TGGGTTTTTATCTGAATAACTCACTGATGCCATCCCAGAAAGTCGGCACCAGGTGTATTT
GATATAGTGTTTGCAACAAATTCGACCCAGGTGATCAAAATGATTCTCAACTCTTCTACT
GAAGATGGTATTAAAAGAATCCAAGATGATTGTCCCAAAGCTGGAAGGCATAATTACATA
TTTGTCATGATTCCTACTTTATACAGTATCATCTTTGTGGTGGGAATATTTGGAAACAGC
TTGGTGGTGATAGTCATTTACTTTTATATGAAGCTGAAGACTGTGGCCAGTGTTTTTCTT
TTGAATTTAGCACTGGCTGACTTATGCTTTTTACTGACTTTGCCACTATGGGCTGTCTAC
ACAGCTATGGAATACCGCTGGCCCTTTGGCAATTACCTATGTAAGATTGCTTCAGCCAGC
GTCAGTTTCAACCTGTACGCTAGTGTGTTTCTACTCACGTGTCTCAGCATTGATCGATAC
CTGGCTATTGTTCACCCAATGAAGTCCCGCCTTCGACGCACAATGCTTGTAGCCAAAGTC
ACCTGCATCATCATTTGGCTGCTGGCAGGCTTGGCCAGTTTGCCAGCTATAATCCATCGA
AATGTATTTTTCATTGAGAACACCAATATTACAGTTTGTGCTTTCCATTATGAGTCCCAA
AATTCAACCCTTCCGATAGGGCTGGGCCTGACCAAAAATATACTGGGTTTCCTGTTTCCT
TTTCTGATCATTCTTACAAGTTATACTCTTATTTGGAAGGCCCTAAAGAAGGCTTATGAA
ATTCAGAAGAACAAACCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTGCTT
TTCTTTTTCTTTTCCTGGATTCCCCACCAAATATTCACTTTTCTGGATGTATTGATTCAA
CTAGGCATCATACGTGACTGTAGAATTGCAGATATTGTGGACACGGCCATGCCTATCACC
ATTTGTATAGCTTATTTTAACAATTGCCTGAATCCTCTTTTTTATGGCTTTCTGGGGAAA
AAATTTAAAAGATATTTTCTCCAGCTTCTAAAATATATTCCCCCAAAAGCCAAATCCCAC
TCAAACCTTTCAACAAAAATGAGCACGCTTTCCTACCGCCCCTCAGATAATGTAAGCTCA
TCCACCAAGAAGCCTGCACCATGTTTTGAGGTTGAGTGACATGTTCGAAACCTGTCCATA
AAGTAATTTTGTGAAAGAAGGAGCAAGAGAACATTCCTCTGCAGCACTTCACTACCAAAT
GAGCATTAGCTACTTTTCATGGGTTTTTATCTGAATAACTCACTGATGCCATCCCAGAAA
GTCGGCACCAGGTGTATTTGATATAGTGTTTGCAACAAATTCGACCCAGGTGATCAAAAT
GATTCTCAACTCTTCTACTGAAGATGGTATTAAAAGAATCCAAGATGATTGTCCCAAAGC
TGGAAGGCATAATTACATATTTGTCATGATTCCTACTTTATACAGTATCATCTTTGTGGT
GGGAATATTTGGAAACAGCTTGGTGGTGATAGTCATTTACTTTTATATGAAGCTGAAGAC
TGTGGCCAGTGTTTTTCTTTTGAATTTAGCACTGGCTGACTTATGCTTTTTACTGACTTT
GCCACTATGGGCTGTCTACACAGCTATGGAATACCGCTGGCCCTTTGGCAATTACCTATG
TAAGATTGCTTCAGCCAGCGTCAGTTTCAACCTGTACGCTAGTGTGTTTCTACTCACGTG
TCTCAGCATTGATCGATACCTGGCTATTGTTCACCCAATGAAGTCCCGCCTTCGACGCAC
AATGCTTGTAGCCAAAGTCACCTGCATCATCATTTGGCTGCTGGCAGGCTTGGCCAGTTT
GCCAGCTATAATCCATCGAAATGTATTTTTCATTGAGAACACCAATATTACAGTTTGTGC
TTTCCATTATGAGTCCCAAAATTCAACCCTTCCGATAGGGCTGGGCCTGACCAAAAATAT
ACTGGGTTTCCTGTTTCCTTTTCTGATCATTCTTACAAGTTATACTCTTATTTGGAAGGC
CCTAAAGAAGGCTTATGAAATTCAGAAGAACAAACCAAGAAATGATGATATTTTTAAGAT
AATTATGGCAATTGTGCTTTTCTTTTTCTTTTCCTGGATTCCCCACCAAATATTCACTTT
TCTGGATGTATTGATTCAACTAGGCATCATACGTGACTGTAGAATTGCAGATATTGTGGA
CACGGCCATGCCTATCACCATTTGTATAGCTTATTTTAACAATTGCCTGAATCCTCTTTT
TTATGGCTTTCTGGGGAAAAAATTTAAAAGATATTTTCTCCAGCTTCTAAAATATATTCC
CCCAAAAGCCAAATCCCACTCAAACCTTTCAACAAAAATGAGCACGCTTTCCTACCGCCC
CTCAGATAATGTAAGCTCATCCACCAAGAAGCCTGCACCATGTTTTGAGGTTGAGTGACA
TGTTCGAAACCTGTCCATAAAGTAATTTTGTGAAAGAAGGAGCAAGAGAACATTCCTCTG
CAGCACTTCACTACCAAATGAGCATTAGCTACTTTTCA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000685 unedited
NNNTTGTCGGATTTTGTATACGACTCCTATAGGGCGGCCGCGATTCGGCACGAGCAGGAC
CCCAGGCAGCAGCGAGTGACAGGACGTCTGGACCGGCGCGCCGCTAGCAGCTCTGCCGGG
CCGCGGCGGTGATCGATGGGGAGCGGCTGGAGCGGACCCAGCGAGTGAGGGCGCACAGCC
GGGACGCCGAGGCGGCGGGCGGGAGACCCGCACCAGCGCAGCCGGCCCTCGGCGGGACGT
GACGCAGCGCCCGGGGCGCGGGTTTGATATTTGACAAATTGATCTAAAATGGCTGGGTTT
TTATCTGAATAACTCACTGATGCCATCCCAGAAAGTCGGCACCAGGTGTATTTGATATAG
TGTTTGCAACAAATTCGACCCAGGTGATCAAAATGATTCTCAACTCTTCTACTGAAGATG
GTATTAAAAGAATCCAAGATGATTGTCCCAAAGCTGGAAGGCATAATTACATATTTGTCA
TGATTCCTACTTTATACAGTATCATCTTTGTGGTGGGAATATTTGGAAACAGCTTGGTGG
TGATAGTCATTTACTTTTATATGAAGCTGAAGACTGTGGCCAGTGTTTTTCTTTTGAATT
TAGCACTGGCTGACTTATGCTTTTTACTGACTTTGCCACTTATGGGCTGTCTACACAGCT
ATGGAATACCGCTGGCCCTTTGGCAATTACCTATGTAAGATTGCTTCAGCCAGCGTCAGT
TTCAACCTGTACGCTAGTGTGTTTCTACTCACGTGTCTCAGCATTGATCGATACCTGGCT
ATTGNTCACCCAATGAAGTCCCGCCTTCGACGCACAATGCTTGTAGCCAAAGTCACCTGC
ATCATCATTTGGCTGCTGGNCAGCTTGGCCAGTTTGCCGCTATTATCCATCGAATGTATT
TTTCATTGAGACACATATTACAGTTT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000685 unedited
NTTTCTTTCAAAATTTTTTTTTTAAGTAAATTAACTTTGCCAGATTTTAATCAATTAACA
GCAGTTTAGAGATATAGATATACATATATATATATGTGTAGAATATATACTTTTTTTAAA
CAGGAAGGCATACTTTATGATATATAATCTTTTTACCACAAACTATATACACTTCTCAGA
TATTAAATCAAACTAATATACTAGGAAGACACTACTACTTGGGACCAGTGCAGCACCTTT
ACAAGTAGTTTAACTTTTATATGTGACTTTAGTAACACCATTATACAAATAAGCCATCTT
ACGGGCATTGTTTTGGCAGTGTAAACCTATAAGACACAGGTTGAATTTCACAAAAAGATC
TGCAACTTGACGACTACTGCTTAGCATATCTTTGTACAAAATGTGCAGTACCAGGTGCAA
GTGTAGCACAGTTGCTAATAGCTGAAAACCGGCACGAAAACTTTACTGCCCTTTGGAAAC
TGGACAGAACAATCTGGAACTCTCATCTCCTGTTGCTCCTCTAACGATTTAATATATTCT
AAATACCTTTATGTGGAAATAAAAAATAACAGGACAAAAGCAGGCTAGGGAGATTGCATT
TCTGTCAGTAAAATTTCTCAAATCAACACATTCATCGAGTTTCTGACATTGTTCTTCGAG
CAGCCGTCATCTGTCTAATGCAAAATGTGGCTTTGCTTTGTCTTGTTGCAAAAGGAAAGA
AAAGCTTTTGTTCAGAGCTTTAGAAAAGTCGGTTCAGTCCACATAATGCATTTTCTCCTT
CAATTCTNGAAAGTAGCTAATGCTCATTTGGTAGTGAAGTGCTGCAGAGGAATGTTCTCT
TGCTCCTTCTTTCACAAATACTNTATGGACAGGNTNNCGACATGTCACTCAACCTCAAAC
AT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000685
ORF Size 1080 bp
Insert Size 2300
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000685.3, NP_000676
RefSeq Size 2347
RefSeq ORF 1080
Locus ID 185
Cytogenetics 3q24
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Vascular smooth muscle contraction, Renin-angiotensin system
Gene Summary Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Multiple alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Jul 2012].
Transcript Variant: This variant (1), also known as pC2, hAT1R-B (PubMed ID:16504375) or hAT1R-C (PubMed ID:11158334), encodes the predominant isoform (1). Variants 1 and 2 encode the same isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations